EMAIL THIS PAGE TO A FRIEND

IGSF1

immunoglobulin superfamily, member 1

209 Gene Product Result for
Synonyms: CHTE IGCD1 IGDC1 INHBP PGSF2 p120
UniProtKB ID: Q8N6C5, B5MEG2, H9KV64, O15070, Q9NTC8
Gene ID:
Human(3547) Summary: This gene encodes a member of the immunoglobulin-like domain-containing superfamily. Proteins in this superfamily contain varying numbers of immunoglobulin-like domains and are thought to participate in the regulation of interactions between cells. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(209268) immunoglobulin superfamily, member 1
Rat(302822) immunoglobulin superfamily, member 1
chicken(419114) immunoglobulin superfamily, member 1
cow(100125775) immunoglobulin superfamily, member 1
Horse(100058129) immunoglobulin superfamily, member 1
domestic cat(101084176) immunoglobulin superfamily, member 1
dog(481051) immunoglobulin superfamily, member 1
sheep(101111779) immunoglobulin superfamily, member 1
domestic guinea pig(100729764) immunoglobulin superfamily, member 1
naked mole-rat(101706561) immunoglobulin superfamily, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001555 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001555 Rosetta Predictions human pricing
NM_205833 Rosetta Predictions human pricing
NM_175763 Rosetta Predictions rat pricing
NM_177591 Rosetta Predictions mouse pricing
NM_177915 Rosetta Predictions mouse pricing
NM_183335 Rosetta Predictions mouse pricing
NM_183336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209173 predicted 326
2 SASI_Hs01_00209174 predicted 431
3 SASI_Hs02_00332120 predicted 551
4 SASI_Hs01_00209175 predicted 553
5 SASI_Hs01_00209176 predicted 468
6 SASI_Hs01_00209178 predicted 391
7 SASI_Hs01_00209179 predicted 510
8 SASI_Hs01_00209181 predicted 422
9 SASI_Hs02_00332121 predicted 198
10 SASI_Hs01_00209182 predicted 238
11 SASI_Hs01_00209177 predicted 397
12 SASI_Hs01_00209180 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236431 predicted 322
2 SASI_Hs01_00236432 predicted 438
3 SASI_Hs02_00373457 predicted 553
4 SASI_Hs01_00236433 predicted 555
5 SASI_Hs01_00236434 predicted 473
6 SASI_Hs01_00236436 predicted 384
7 SASI_Hs01_00236437 predicted 507
8 SASI_Hs01_00236439 predicted 426
9 SASI_Hs02_00373458 predicted 201
10 SASI_Hs01_00236440 predicted 238
11 SASI_Hs01_00236435 predicted 391
12 SASI_Hs01_00236438 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118514 predicted 1339
2 SASI_Rn02_00269519 predicted 1673
3 SASI_Rn02_00269520 predicted 1133
4 SASI_Rn01_00118515 predicted 3491
5 SASI_Rn02_00269521 predicted 1302
6 SASI_Rn01_00118516 predicted 2830
7 SASI_Rn01_00118518 predicted 638
8 SASI_Rn01_00118520 predicted 2658
9 SASI_Rn01_00118521 predicted 437
10 SASI_Rn01_00118522 predicted 885
11 SASI_Rn01_00118517 predicted 2716
12 SASI_Rn01_00118519 predicted 1858
13 SASI_Rn01_00118523 predicted 3430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051807 predicted 3491
2 SASI_Mm01_00051808 predicted 3070
3 SASI_Mm01_00051809 predicted 2931
4 SASI_Mm01_00051810 predicted 4007
5 SASI_Mm01_00051811 predicted 3211
6 SASI_Mm01_00051812 predicted 1963
7 SASI_Mm01_00051813 predicted 3385
8 SASI_Mm01_00051814 predicted 3684
9 SASI_Mm01_00051815 predicted 4118
10 SASI_Mm01_00051816 predicted 3248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088743 predicted 541
2 SASI_Mm01_00088744 predicted 483
3 SASI_Mm01_00088745 predicted 500
4 SASI_Mm01_00088746 predicted 347
5 SASI_Mm01_00088748 predicted 415
6 SASI_Mm01_00088750 predicted 405
7 SASI_Mm02_00348401 predicted 501
8 SASI_Mm01_00088751 predicted 405
9 SASI_Mm02_00348402 predicted 311
10 SASI_Mm02_00348403 predicted 400
11 SASI_Mm01_00088747 predicted 357
12 SASI_Mm01_00088749 predicted 357
13 SASI_Mm01_00088752 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076331 predicted 435
2 SASI_Mm01_00076332 predicted 378
3 SASI_Mm01_00076333 predicted 395
4 SASI_Mm01_00076334 predicted 232
5 SASI_Mm01_00076336 predicted 312
6 SASI_Mm01_00076338 predicted 294
7 SASI_Mm02_00350466 predicted 391
8 SASI_Mm01_00076339 predicted 304
9 SASI_Mm02_00350467 predicted 202
10 SASI_Mm02_00350468 predicted 292
11 SASI_Mm01_00076335 predicted 248
12 SASI_Mm01_00076337 predicted 250
13 SASI_Mm01_00076340 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060767 predicted 1741
2 SASI_Mm01_00060768 predicted 1322
3 SASI_Mm01_00060769 predicted 1180
4 SASI_Mm01_00060770 predicted 2267
5 SASI_Mm01_00060771 predicted 1470
6 SASI_Mm01_00060772 predicted 222
7 SASI_Mm01_00060773 predicted 1645
8 SASI_Mm01_00060774 predicted 1939
9 SASI_Mm01_00060775 predicted 2369
10 SASI_Mm01_00060776 predicted 1504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001555
IGSF1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-2773s21c1
Sequence:CCGGGAATTACAGCTGCCGATATTACTCGAGTAATATCGGCAGCTGTAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-826s21c1
Sequence:CCGGTTACATCTGCCGCACTCATATCTCGAGATATGAGTGCGGCAGATGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-529s21c1
Sequence:CCGGTGAGTCCAATGCAGGTCTTTACTCGAGTAAAGACCTGCATTGGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-2626s1c1
Sequence:CCGGGCAGCTCACTTTCTAATCATTCTCGAGAATGATTAGAAAGTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001555.2-4196s1c1
Sequence:CCGGGACCTATAAATCCAACCAGTTCTCGAGAACTGGTTGGATTTATAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-4045s1c1
Sequence:CCGGGCCCTTGAAGAGTGTAACCAACTCGAGTTGGTTACACTCTTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-885s1c1
Sequence:CCGGGCCAATCTATGGAATGACCTTCTCGAGAAGGTCATTCCATAGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-1248s1c1
Sequence:CCGGCGATGACAACACATCATTCTTCTCGAGAAGAATGATGTGTTGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001555
IGSF1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-2773s21c1
Sequence:CCGGGAATTACAGCTGCCGATATTACTCGAGTAATATCGGCAGCTGTAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-826s21c1
Sequence:CCGGTTACATCTGCCGCACTCATATCTCGAGATATGAGTGCGGCAGATGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-529s21c1
Sequence:CCGGTGAGTCCAATGCAGGTCTTTACTCGAGTAAAGACCTGCATTGGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-2626s1c1
Sequence:CCGGGCAGCTCACTTTCTAATCATTCTCGAGAATGATTAGAAAGTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001555.2-4196s1c1
Sequence:CCGGGACCTATAAATCCAACCAGTTCTCGAGAACTGGTTGGATTTATAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-4045s1c1
Sequence:CCGGGCCCTTGAAGAGTGTAACCAACTCGAGTTGGTTACACTCTTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-885s1c1
Sequence:CCGGGCCAATCTATGGAATGACCTTCTCGAGAAGGTCATTCCATAGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-1248s1c1
Sequence:CCGGCGATGACAACACATCATTCTTCTCGAGAAGAATGATGTGTTGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001555
IGSF1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-2773s21c1
Sequence:CCGGGAATTACAGCTGCCGATATTACTCGAGTAATATCGGCAGCTGTAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-826s21c1
Sequence:CCGGTTACATCTGCCGCACTCATATCTCGAGATATGAGTGCGGCAGATGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001555.3-529s21c1
Sequence:CCGGTGAGTCCAATGCAGGTCTTTACTCGAGTAAAGACCTGCATTGGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-2626s1c1
Sequence:CCGGGCAGCTCACTTTCTAATCATTCTCGAGAATGATTAGAAAGTGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001555.2-4196s1c1
Sequence:CCGGGACCTATAAATCCAACCAGTTCTCGAGAACTGGTTGGATTTATAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-4045s1c1
Sequence:CCGGGCCCTTGAAGAGTGTAACCAACTCGAGTTGGTTACACTCTTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-885s1c1
Sequence:CCGGGCCAATCTATGGAATGACCTTCTCGAGAAGGTCATTCCATAGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001555.2-1248s1c1
Sequence:CCGGCGATGACAACACATCATTCTTCTCGAGAAGAATGATGTGTTGTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177915
IGSF1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177915.2-1372s1c1
Sequence:CCGGCCCTGGATGATTCCAAACAAACTCGAGTTTGTTTGGAATCATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-589s1c1
Sequence:CCGGGCTCCAGGATTTGGTATTTATCTCGAGATAAATACCAAATCCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-241s1c1
Sequence:CCGGGCTATGGATAGAGTCCAACTACTCGAGTAGTTGGACTCTATCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-371s1c1
Sequence:CCGGCCTTACAAGACATTCCAAGTTCTCGAGAACTTGGAATGTCTTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-636s1c1
Sequence:CCGGCCGTAGATTACCAAGTCCCAACTCGAGTTGGGACTTGGTAATCTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177915
IGSF1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177915.2-1372s1c1
Sequence:CCGGCCCTGGATGATTCCAAACAAACTCGAGTTTGTTTGGAATCATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-589s1c1
Sequence:CCGGGCTCCAGGATTTGGTATTTATCTCGAGATAAATACCAAATCCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-241s1c1
Sequence:CCGGGCTATGGATAGAGTCCAACTACTCGAGTAGTTGGACTCTATCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-371s1c1
Sequence:CCGGCCTTACAAGACATTCCAAGTTCTCGAGAACTTGGAATGTCTTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-636s1c1
Sequence:CCGGCCGTAGATTACCAAGTCCCAACTCGAGTTGGGACTTGGTAATCTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177915
IGSF1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177915.2-1372s1c1
Sequence:CCGGCCCTGGATGATTCCAAACAAACTCGAGTTTGTTTGGAATCATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-589s1c1
Sequence:CCGGGCTCCAGGATTTGGTATTTATCTCGAGATAAATACCAAATCCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-241s1c1
Sequence:CCGGGCTATGGATAGAGTCCAACTACTCGAGTAGTTGGACTCTATCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-371s1c1
Sequence:CCGGCCTTACAAGACATTCCAAGTTCTCGAGAACTTGGAATGTCTTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177915.2-636s1c1
Sequence:CCGGCCGTAGATTACCAAGTCCCAACTCGAGTTGGGACTTGGTAATCTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)