EMAIL THIS PAGE TO A FRIEND

IGSF21

immunoglobin superfamily, member 21

52 Gene Product Result for
UniProtKB ID: Q96ID5, Q8NBR8
Gene ID:
Human(84966) Summary: This gene encodes a protein which has two immunoglobulin (Ig) domains and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Sep 2011]
Mouse(230868) immunoglobulin superfamily, member 21
Rat(298591) immunoglobin superfamily, member 21
chicken(419359) immunoglobin superfamily, member 21
cow(508119) immunoglobin superfamily, member 21
domestic cat(101087249) immunoglobin superfamily, member 21
dog(478214) immunoglobin superfamily, member 21
domestic guinea pig(100734444) immunoglobin superfamily, member 21
naked mole-rat(101725801) immunoglobin superfamily, member 21
sheep(101106668) immunoglobin superfamily, member 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032880 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032880 Rosetta Predictions human pricing
XM_216568 Rosetta Predictions rat pricing
NM_198610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085493 predicted 1286
2 SASI_Hs01_00085494 predicted 1222
3 SASI_Hs01_00085495 predicted 1703
4 SASI_Hs01_00085496 predicted 1448
5 SASI_Hs01_00085497 predicted 1301
6 SASI_Hs01_00085498 predicted 704
7 SASI_Hs01_00085499 predicted 1454
8 SASI_Hs01_00085500 predicted 911
9 SASI_Hs01_00085501 predicted 1480
10 SASI_Hs01_00085502 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376690 predicted 251
2 SASI_Rn02_00376691 predicted 216
3 SASI_Rn02_00376692 predicted 213
4 SASI_Rn02_00376693 predicted 258
5 SASI_Rn02_00376694 predicted 260
6 SASI_Rn02_00376695 predicted 211
7 SASI_Rn02_00376696 predicted 254
8 SASI_Rn02_00376697 predicted 212
9 SASI_Rn02_00376698 predicted 261
10 SASI_Rn02_00376699 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069782 predicted 553
2 SASI_Mm01_00069784 predicted 1057
3 SASI_Mm01_00069786 predicted 690
4 SASI_Mm02_00351026 predicted 1681
5 SASI_Mm01_00069787 predicted 1092
6 SASI_Mm01_00069788 predicted 1487
7 SASI_Mm01_00069789 predicted 654
8 SASI_Mm01_00069790 predicted 609
9 SASI_Mm01_00069791 predicted 565
10 SASI_Mm02_00351027 predicted 1478
11 SASI_Mm01_00069783 predicted 735
12 SASI_Mm01_00069785 predicted 897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032880
IGSF21 MISSION shRNA Bacterial Glycerol Stock
immunoglobin superfamily, member 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-620s1c1
Sequence:CCGGCTCCACCAACTACTCACACATCTCGAGATGTGTGAGTAGTTGGTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-626s1c1
Sequence:CCGGCAACTACTCACACATGGAGAACTCGAGTTCTCCATGTGTGAGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-704s1c1
Sequence:CCGGGATCTCAGACAATGGTCCCTACTCGAGTAGGGACCATTGTCTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-506s1c1
Sequence:CCGGCGTGACTTTGAAGTGTAACTTCTCGAGAAGTTACACTTCAAAGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-454s21c1
Sequence:CCGGGCTACCTGACAGTCAACATTGCTCGAGCAATGTTGACTGTCAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-697s21c1
Sequence:CCGGAGGTCCGGATCTCAGACAATGCTCGAGCATTGTCTGAGATCCGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-911s21c1
Sequence:CCGGACCAGCACCCATGGTTTATTTCTCGAGAAATAAACCATGGGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-504s21c1
Sequence:CCGGGCCGTGACTTTGAAGTGTAACCTCGAGGTTACACTTCAAAGTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032880
IGSF21 MISSION shRNA shRNA Plasmid DNA
immunoglobin superfamily, member 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-620s1c1
Sequence:CCGGCTCCACCAACTACTCACACATCTCGAGATGTGTGAGTAGTTGGTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-626s1c1
Sequence:CCGGCAACTACTCACACATGGAGAACTCGAGTTCTCCATGTGTGAGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-704s1c1
Sequence:CCGGGATCTCAGACAATGGTCCCTACTCGAGTAGGGACCATTGTCTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-506s1c1
Sequence:CCGGCGTGACTTTGAAGTGTAACTTCTCGAGAAGTTACACTTCAAAGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-454s21c1
Sequence:CCGGGCTACCTGACAGTCAACATTGCTCGAGCAATGTTGACTGTCAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-697s21c1
Sequence:CCGGAGGTCCGGATCTCAGACAATGCTCGAGCATTGTCTGAGATCCGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-911s21c1
Sequence:CCGGACCAGCACCCATGGTTTATTTCTCGAGAAATAAACCATGGGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-504s21c1
Sequence:CCGGGCCGTGACTTTGAAGTGTAACCTCGAGGTTACACTTCAAAGTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032880
IGSF21 MISSION shRNA Lentiviral Transduction Particles
immunoglobin superfamily, member 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-620s1c1
Sequence:CCGGCTCCACCAACTACTCACACATCTCGAGATGTGTGAGTAGTTGGTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-626s1c1
Sequence:CCGGCAACTACTCACACATGGAGAACTCGAGTTCTCCATGTGTGAGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-704s1c1
Sequence:CCGGGATCTCAGACAATGGTCCCTACTCGAGTAGGGACCATTGTCTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032880.2-506s1c1
Sequence:CCGGCGTGACTTTGAAGTGTAACTTCTCGAGAAGTTACACTTCAAAGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-454s21c1
Sequence:CCGGGCTACCTGACAGTCAACATTGCTCGAGCAATGTTGACTGTCAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-697s21c1
Sequence:CCGGAGGTCCGGATCTCAGACAATGCTCGAGCATTGTCTGAGATCCGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-911s21c1
Sequence:CCGGACCAGCACCCATGGTTTATTTCTCGAGAAATAAACCATGGGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032880.2-504s21c1
Sequence:CCGGGCCGTGACTTTGAAGTGTAACCTCGAGGTTACACTTCAAAGTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198610
IGSF21 MISSION shRNA Bacterial Glycerol Stock
immunoglobin superfamily, member 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-1505s1c1
Sequence:CCGGCGGATTTCAGAATGAGGTCTTCTCGAGAAGACCTCATTCTGAAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-1065s1c1
Sequence:CCGGCGAGACGTGGATGATACCAAACTCGAGTTTGGTATCATCCACGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-945s1c1
Sequence:CCGGGCGCCCATGGTTTATTTCAAACTCGAGTTTGAAATAAACCATGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-665s1c1
Sequence:CCGGGCACATGGAGAATTACCGCAACTCGAGTTGCGGTAATTCTCCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-810s1c1
Sequence:CCGGTCAGGCAACATCTTCCTCAATCTCGAGATTGAGGAAGATGTTGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198610
IGSF21 MISSION shRNA shRNA Plasmid DNA
immunoglobin superfamily, member 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-1505s1c1
Sequence:CCGGCGGATTTCAGAATGAGGTCTTCTCGAGAAGACCTCATTCTGAAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-1065s1c1
Sequence:CCGGCGAGACGTGGATGATACCAAACTCGAGTTTGGTATCATCCACGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-945s1c1
Sequence:CCGGGCGCCCATGGTTTATTTCAAACTCGAGTTTGAAATAAACCATGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-665s1c1
Sequence:CCGGGCACATGGAGAATTACCGCAACTCGAGTTGCGGTAATTCTCCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-810s1c1
Sequence:CCGGTCAGGCAACATCTTCCTCAATCTCGAGATTGAGGAAGATGTTGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198610
IGSF21 MISSION shRNA Lentiviral Transduction Particles
immunoglobin superfamily, member 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-1505s1c1
Sequence:CCGGCGGATTTCAGAATGAGGTCTTCTCGAGAAGACCTCATTCTGAAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-1065s1c1
Sequence:CCGGCGAGACGTGGATGATACCAAACTCGAGTTTGGTATCATCCACGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-945s1c1
Sequence:CCGGGCGCCCATGGTTTATTTCAAACTCGAGTTTGAAATAAACCATGGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-665s1c1
Sequence:CCGGGCACATGGAGAATTACCGCAACTCGAGTTGCGGTAATTCTCCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198610.1-810s1c1
Sequence:CCGGTCAGGCAACATCTTCCTCAATCTCGAGATTGAGGAAGATGTTGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)