EMAIL THIS PAGE TO A FRIEND

IGSF22

immunoglobulin superfamily, member 22

60 Gene Product Result for
UniProtKB ID: Q8N9C0, A6NNA0, D6RGV7
Gene ID:
domestic cat(101081409) immunoglobulin superfamily, member 22
cow(787080) immunoglobulin superfamily, member 22
dog(485408) immunoglobulin superfamily, member 22
sheep(101121384) immunoglobulin superfamily, member 22
domestic guinea pig(101787373) immunoglobulin superfamily, member 22
naked mole-rat(101710221) immunoglobulin superfamily, member 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173588 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173588 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368426 predicted 940
2 SASI_Hs01_00142096 predicted 2785
3 SASI_Hs02_00368427 predicted 1449
4 SASI_Hs02_00368428 predicted 950
5 SASI_Hs02_00368429 predicted 2941
6 SASI_Hs02_00368430 predicted 651
7 SASI_Hs02_00368431 predicted 1240
8 SASI_Hs02_00368432 predicted 630
9 SASI_Hs01_00142102 predicted 1864
10 SASI_Hs02_00368433 predicted 645
11 SASI_Hs01_00142094 predicted 2490
12 SASI_Hs01_00142095 predicted 1078
13 SASI_Hs01_00142097 predicted 1063
14 SASI_Hs01_00142098 predicted 1252
15 SASI_Hs01_00142099 predicted 1574
16 SASI_Hs01_00142100 predicted 286
17 SASI_Hs01_00142101 predicted 1786
18 SASI_Hs01_00142103 predicted 1787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173588
IGSF22 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.3-1062s21c1
Sequence:CCGGCCAAGTACATGCTGGTTATTACTCGAGTAATAACCAGCATGTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.3-2511s21c1
Sequence:CCGGTCCGTATCCTGGCAGTCAATTCTCGAGAATTGACTGCCAGGATACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-1335s21c1
Sequence:CCGGTGACGCACACGCTTAAGATTACTCGAGTAATCTTAAGCGTGTGCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-625s21c1
Sequence:CCGGCCATGCAGATGCCATCTATACCTCGAGGTATAGATGGCATCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-816s21c1
Sequence:CCGGAGTATGGTTTCACCGACTTTCCTCGAGGAAAGTCGGTGAAACCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173588.2-2967s21c1
Sequence:CCGGCACTCCCAGTTCCTCATTAATCTCGAGATTAATGAGGAACTGGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-1602s21c1
Sequence:CCGGAGCGAGCAGAGCTGATCATTGCTCGAGCAATGATCAGCTCTGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173588.1-3093s1c1
Sequence:CCGGCCCACAAACCTACGGTTGTTTCTCGAGAAACAACCGTAGGTTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173588.1-976s1c1
Sequence:CCGGCAATGTCAAGATGATATGGATCTCGAGATCCATATCATCTTGACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173588
IGSF22 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.3-1062s21c1
Sequence:CCGGCCAAGTACATGCTGGTTATTACTCGAGTAATAACCAGCATGTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.3-2511s21c1
Sequence:CCGGTCCGTATCCTGGCAGTCAATTCTCGAGAATTGACTGCCAGGATACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-1335s21c1
Sequence:CCGGTGACGCACACGCTTAAGATTACTCGAGTAATCTTAAGCGTGTGCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-625s21c1
Sequence:CCGGCCATGCAGATGCCATCTATACCTCGAGGTATAGATGGCATCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-816s21c1
Sequence:CCGGAGTATGGTTTCACCGACTTTCCTCGAGGAAAGTCGGTGAAACCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173588.2-2967s21c1
Sequence:CCGGCACTCCCAGTTCCTCATTAATCTCGAGATTAATGAGGAACTGGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-1602s21c1
Sequence:CCGGAGCGAGCAGAGCTGATCATTGCTCGAGCAATGATCAGCTCTGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173588.1-3093s1c1
Sequence:CCGGCCCACAAACCTACGGTTGTTTCTCGAGAAACAACCGTAGGTTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173588.1-976s1c1
Sequence:CCGGCAATGTCAAGATGATATGGATCTCGAGATCCATATCATCTTGACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173588
IGSF22 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.3-1062s21c1
Sequence:CCGGCCAAGTACATGCTGGTTATTACTCGAGTAATAACCAGCATGTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.3-2511s21c1
Sequence:CCGGTCCGTATCCTGGCAGTCAATTCTCGAGAATTGACTGCCAGGATACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-1335s21c1
Sequence:CCGGTGACGCACACGCTTAAGATTACTCGAGTAATCTTAAGCGTGTGCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-625s21c1
Sequence:CCGGCCATGCAGATGCCATCTATACCTCGAGGTATAGATGGCATCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-816s21c1
Sequence:CCGGAGTATGGTTTCACCGACTTTCCTCGAGGAAAGTCGGTGAAACCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173588.2-2967s21c1
Sequence:CCGGCACTCCCAGTTCCTCATTAATCTCGAGATTAATGAGGAACTGGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173588.2-1602s21c1
Sequence:CCGGAGCGAGCAGAGCTGATCATTGCTCGAGCAATGATCAGCTCTGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173588.1-3093s1c1
Sequence:CCGGCCCACAAACCTACGGTTGTTTCTCGAGAAACAACCGTAGGTTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173588.1-976s1c1
Sequence:CCGGCAATGTCAAGATGATATGGATCTCGAGATCCATATCATCTTGACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)