EMAIL THIS PAGE TO A FRIEND

IGSF23

immunoglobulin superfamily, member 23

92 Gene Product Result for
UniProtKB ID: A1L1A6
Gene ID:
Human(147710) Summary: This gene encodes a protein that has one immunoglobulin (Ig) domain and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Nov 2011]
Mouse(70080) immunoglobulin superfamily, member 23
Rat(502306) immunoglobulin superfamily, member 23
dog(612360) immunoglobulin superfamily, member 23
cow(789978) immunoglobulin superfamily, member 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU198951 MISSION® esiRNA esiRNA targeting mouse 2210010C17Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724591 Rosetta Predictions human pricing
XM_097278 Rosetta Predictions human pricing
XM_941067 Rosetta Predictions human pricing
XM_577770 Rosetta Predictions rat pricing
NM_027308 Rosetta Predictions mouse pricing
XM_885902 Rosetta Predictions mouse pricing
XM_896455 Rosetta Predictions mouse pricing
XM_896487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00462585 predicted 229
2 SASI_Hs02_00462586 predicted 372
3 SASI_Hs02_00462587 predicted 227
4 SASI_Hs02_00462588 predicted 357
5 SASI_Hs02_00462589 predicted 280
6 SASI_Hs02_00462590 predicted 318
7 SASI_Hs02_00462591 predicted 266
8 SASI_Hs02_00462592 predicted 407
9 SASI_Hs02_00462593 predicted 348
10 SASI_Hs02_00462594 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_097278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265926 predicted 235
2 SASI_Hs01_00265927 predicted 365
3 SASI_Hs01_00265928 predicted 225
4 SASI_Hs01_00265929 predicted 354
5 SASI_Hs01_00265931 predicted 279
6 SASI_Hs01_00265932 predicted 320
7 SASI_Hs01_00265933 predicted 263
8 SASI_Hs01_00265935 predicted 355
9 SASI_Hs02_00478856 predicted 262
10 SASI_Hs02_00478857 predicted 215
11 SASI_Hs01_00265930 predicted 237
12 SASI_Hs01_00265934 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484639 predicted 231
2 SASI_Hs02_00484640 predicted 368
3 SASI_Hs02_00484641 predicted 230
4 SASI_Hs02_00484642 predicted 356
5 SASI_Hs02_00484643 predicted 282
6 SASI_Hs02_00484644 predicted 315
7 SASI_Hs02_00484645 predicted 264
8 SASI_Hs02_00484646 predicted 407
9 SASI_Hs02_00484647 predicted 348
10 SASI_Hs02_00484648 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407037 predicted 440
2 SASI_Rn02_00407038 predicted 475
3 SASI_Rn02_00407039 predicted 295
4 SASI_Rn02_00407040 predicted 214
5 SASI_Rn02_00407041 predicted 366
6 SASI_Rn02_00407042 predicted 295
7 SASI_Rn02_00407043 predicted 472
8 SASI_Rn02_00407044 predicted 489
9 SASI_Rn02_00407045 predicted 510
10 SASI_Rn02_00407046 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331919 predicted 897
2 SASI_Mm02_00331920 predicted 1140
3 SASI_Mm02_00331921 predicted 974
4 SASI_Mm02_00331922 predicted 539
5 SASI_Mm02_00331923 predicted 1195
6 SASI_Mm02_00331924 predicted 633
7 SASI_Mm02_00331925 predicted 569
8 SASI_Mm02_00331926 predicted 578
9 SASI_Mm02_00331927 predicted 1143
10 SASI_Mm02_00331928 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262395 predicted 824
2 SASI_Mm01_00262396 predicted 896
3 SASI_Mm01_00262397 predicted 1143
4 SASI_Mm01_00262398 predicted 976
5 SASI_Mm01_00262399 predicted 554
6 SASI_Mm01_00262400 predicted 1195
7 SASI_Mm01_00262401 predicted 634
8 SASI_Mm01_00262402 predicted 575
9 SASI_Mm01_00262403 predicted 581
10 SASI_Mm01_00262404 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284636 predicted 555
2 SASI_Mm01_00284637 predicted 541
3 SASI_Mm01_00284638 predicted 634
4 SASI_Mm01_00284639 predicted 574
5 SASI_Mm01_00284640 predicted 602
6 SASI_Mm01_00284641 predicted 566
7 SASI_Mm01_00284642 predicted 589
8 SASI_Mm01_00284643 predicted 491
9 SASI_Mm01_00284644 predicted 645
10 SASI_Mm01_00284645 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235864 predicted 635
2 SASI_Mm01_00235865 predicted 1127
3 SASI_Mm01_00235866 predicted 706
4 SASI_Mm01_00235867 predicted 949
5 SASI_Mm01_00235868 predicted 782
6 SASI_Mm01_00235869 predicted 359
7 SASI_Mm01_00235870 predicted 1008
8 SASI_Mm01_00235871 predicted 437
9 SASI_Mm01_00235872 predicted 372
10 SASI_Mm01_00235873 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027308
IGSF23 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027308.2-1501s21c1
Sequence:CCGGAGGTAAACGCCAACCGATTACCTCGAGGTAATCGGTTGGCGTTTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-914s21c1
Sequence:CCGGGGATCTGTCTGCTTCTATATACTCGAGTATATAGAAGCAGACAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-277s21c1
Sequence:CCGGCTGGGAGACGCTTCTACTAACCTCGAGGTTAGTAGAAGCGTCTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-545s21c1
Sequence:CCGGGAGTCTTCCAAGGGCATAATCCTCGAGGATTATGCCCTTGGAAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-495s21c1
Sequence:CCGGTGCCGAACGCTGAAGACAATCCTCGAGGATTGTCTTCAGCGTTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027308
IGSF23 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027308.2-1501s21c1
Sequence:CCGGAGGTAAACGCCAACCGATTACCTCGAGGTAATCGGTTGGCGTTTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-914s21c1
Sequence:CCGGGGATCTGTCTGCTTCTATATACTCGAGTATATAGAAGCAGACAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-277s21c1
Sequence:CCGGCTGGGAGACGCTTCTACTAACCTCGAGGTTAGTAGAAGCGTCTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-545s21c1
Sequence:CCGGGAGTCTTCCAAGGGCATAATCCTCGAGGATTATGCCCTTGGAAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-495s21c1
Sequence:CCGGTGCCGAACGCTGAAGACAATCCTCGAGGATTGTCTTCAGCGTTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027308
IGSF23 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027308.2-1501s21c1
Sequence:CCGGAGGTAAACGCCAACCGATTACCTCGAGGTAATCGGTTGGCGTTTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-914s21c1
Sequence:CCGGGGATCTGTCTGCTTCTATATACTCGAGTATATAGAAGCAGACAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-277s21c1
Sequence:CCGGCTGGGAGACGCTTCTACTAACCTCGAGGTTAGTAGAAGCGTCTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-545s21c1
Sequence:CCGGGAGTCTTCCAAGGGCATAATCCTCGAGGATTATGCCCTTGGAAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027308.2-495s21c1
Sequence:CCGGTGCCGAACGCTGAAGACAATCCTCGAGGATTGTCTTCAGCGTTCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)