EMAIL THIS PAGE TO A FRIEND

IGSF3

immunoglobulin superfamily, member 3

187 Gene Product Result for
Synonyms: EWI-3 V8
UniProtKB ID: O75054, A6NJZ6, A6NMC7
Gene ID:
Mouse(78908) immunoglobulin superfamily, member 3
Rat(295325) immunoglobulin superfamily, member 3
chicken(418451) immunoglobulin superfamily, member 3
dog(483139) immunoglobulin superfamily, member 3
domestic cat(101083953) immunoglobulin superfamily, member 3
cow(530939) immunoglobulin superfamily, member 3
Horse(100059648) immunoglobulin superfamily, member 3
sheep(101110899) immunoglobulin superfamily, member 3
Domestic Rabbit(100349004) immunoglobulin superfamily, member 3
domestic guinea pig(100734767) immunoglobulin superfamily, member 3
naked mole-rat(101698264) immunoglobulin superfamily, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001542 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007237 Rosetta Predictions human pricing
NM_001542 Rosetta Predictions human pricing
NM_001106455 Rosetta Predictions rat pricing
NM_207205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305254 predicted 1606
2 SASI_Hs02_00305255 predicted 811
3 SASI_Hs02_00305256 predicted 1074
4 SASI_Hs02_00305257 predicted 1006
5 SASI_Hs01_00165464 predicted 2830
6 SASI_Hs01_00165465 predicted 4114
7 SASI_Hs01_00165466 predicted 4388
8 SASI_Hs01_00165468 predicted 2913
9 SASI_Hs02_00305258 predicted 1412
10 SASI_Hs02_00305259 predicted 1081
11 SASI_Hs01_00165467 predicted 3121
12 SASI_Hs01_00165469 predicted 3092
13 SASI_Hs01_00165470 predicted 2907
14 SASI_Hs01_00165471 predicted 3220
15 SASI_Hs01_00165472 predicted 2743
16 SASI_Hs01_00165473 predicted 4173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332079 predicted 2284
2 SASI_Hs02_00332080 predicted 1601
3 SASI_Hs01_00211971 predicted 2797
4 SASI_Hs02_00332081 predicted 812
5 SASI_Hs02_00332082 predicted 1070
6 SASI_Hs02_00332083 predicted 1011
7 SASI_Hs01_00211972 predicted 2889
8 SASI_Hs01_00211973 predicted 4168
9 SASI_Hs01_00211974 predicted 4444
10 SASI_Hs01_00211976 predicted 2972
11 SASI_Hs01_00211975 predicted 3183
12 SASI_Hs01_00211977 predicted 3145
13 SASI_Hs01_00211978 predicted 2967
14 SASI_Hs01_00211979 predicted 3288
15 SASI_Hs01_00211980 predicted 4228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219128 predicted 3029
2 SASI_Rn02_00219129 predicted 2594
3 SASI_Rn02_00219130 predicted 2583
4 SASI_Rn02_00219131 predicted 1647
5 SASI_Rn02_00219132 predicted 1703
6 SASI_Rn02_00219133 predicted 606
7 SASI_Rn02_00219134 predicted 1990
8 SASI_Rn02_00219135 predicted 1817
9 SASI_Rn02_00219136 predicted 723
10 SASI_Rn02_00219137 predicted 2004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130102 predicted 4142
2 SASI_Mm01_00130103 predicted 2807
3 SASI_Mm01_00130104 predicted 4037
4 SASI_Mm01_00130105 predicted 2234
5 SASI_Mm01_00130107 predicted 828
6 SASI_Mm01_00130109 predicted 1702
7 SASI_Mm02_00351926 predicted 3102
8 SASI_Mm01_00130110 predicted 1672
9 SASI_Mm01_00130111 predicted 878
10 SASI_Mm01_00130108 predicted 3089
11 SASI_Mm01_00130106 predicted 2526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001542
IGSF3 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001542.2-4147s21c1
Sequence:CCGGTTCGTCTTCTTCTACCCTTTCCTCGAGGAAAGGGTAGAAGAAGACGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001542.2-4661s21c1
Sequence:CCGGGATGTTACAGGGCTTCTTATTCTCGAGAATAAGAAGCCCTGTAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001542.2-3734s21c1
Sequence:CCGGGGTATTCCCTGAGGACTAAAGCTCGAGCTTTAGTCCTCAGGGAATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001542.2-4624s21c1
Sequence:CCGGCACATCTACTCACAGATTTATCTCGAGATAAATCTGTGAGTAGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-1534s1c1
Sequence:CCGGCGCAGCAATATCATGTGGCTACTCGAGTAGCCACATGATATTGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-1326s1c1
Sequence:CCGGCACAGATAACTGGGTAGTTAACTCGAGTTAACTACCCAGTTATCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-474s1c1
Sequence:CCGGCAGCACTGATAAGCAATACTTCTCGAGAAGTATTGCTTATCAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-2376s1c1
Sequence:CCGGCGCCTTTGAATACGGTACTTACTCGAGTAAGTACCGTATTCAAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001542
IGSF3 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001542.2-4147s21c1
Sequence:CCGGTTCGTCTTCTTCTACCCTTTCCTCGAGGAAAGGGTAGAAGAAGACGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001542.2-4661s21c1
Sequence:CCGGGATGTTACAGGGCTTCTTATTCTCGAGAATAAGAAGCCCTGTAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001542.2-3734s21c1
Sequence:CCGGGGTATTCCCTGAGGACTAAAGCTCGAGCTTTAGTCCTCAGGGAATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001542.2-4624s21c1
Sequence:CCGGCACATCTACTCACAGATTTATCTCGAGATAAATCTGTGAGTAGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-1534s1c1
Sequence:CCGGCGCAGCAATATCATGTGGCTACTCGAGTAGCCACATGATATTGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-1326s1c1
Sequence:CCGGCACAGATAACTGGGTAGTTAACTCGAGTTAACTACCCAGTTATCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-474s1c1
Sequence:CCGGCAGCACTGATAAGCAATACTTCTCGAGAAGTATTGCTTATCAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-2376s1c1
Sequence:CCGGCGCCTTTGAATACGGTACTTACTCGAGTAAGTACCGTATTCAAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001542
IGSF3 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001542.2-4147s21c1
Sequence:CCGGTTCGTCTTCTTCTACCCTTTCCTCGAGGAAAGGGTAGAAGAAGACGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001542.2-4661s21c1
Sequence:CCGGGATGTTACAGGGCTTCTTATTCTCGAGAATAAGAAGCCCTGTAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001542.2-3734s21c1
Sequence:CCGGGGTATTCCCTGAGGACTAAAGCTCGAGCTTTAGTCCTCAGGGAATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001542.2-4624s21c1
Sequence:CCGGCACATCTACTCACAGATTTATCTCGAGATAAATCTGTGAGTAGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-1534s1c1
Sequence:CCGGCGCAGCAATATCATGTGGCTACTCGAGTAGCCACATGATATTGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-1326s1c1
Sequence:CCGGCACAGATAACTGGGTAGTTAACTCGAGTTAACTACCCAGTTATCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-474s1c1
Sequence:CCGGCAGCACTGATAAGCAATACTTCTCGAGAAGTATTGCTTATCAGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001542.1-2376s1c1
Sequence:CCGGCGCCTTTGAATACGGTACTTACTCGAGTAAGTACCGTATTCAAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194109
IGSF3 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000105695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194109.2-4793s1c1
Sequence:CCGGGCCTTCATAGTAACAAGGATTCTCGAGAATCCTTGTTACTATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-1603s1c1
Sequence:CCGGCCGTGCGTCTGGAAACAGATACTCGAGTATCTGTTTCCAGACGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-1151s1c1
Sequence:CCGGGAGTTACAGTGCCAAGATGAACTCGAGTTCATCTTGGCACTGTAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-2705s1c1
Sequence:CCGGGTGGCGAAGGAATTACAACAACTCGAGTTGTTGTAATTCCTTCGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194109
IGSF3 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000105695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194109.2-4793s1c1
Sequence:CCGGGCCTTCATAGTAACAAGGATTCTCGAGAATCCTTGTTACTATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-1603s1c1
Sequence:CCGGCCGTGCGTCTGGAAACAGATACTCGAGTATCTGTTTCCAGACGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-1151s1c1
Sequence:CCGGGAGTTACAGTGCCAAGATGAACTCGAGTTCATCTTGGCACTGTAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-2705s1c1
Sequence:CCGGGTGGCGAAGGAATTACAACAACTCGAGTTGTTGTAATTCCTTCGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194109
IGSF3 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000105695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194109.2-4793s1c1
Sequence:CCGGGCCTTCATAGTAACAAGGATTCTCGAGAATCCTTGTTACTATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-1603s1c1
Sequence:CCGGCCGTGCGTCTGGAAACAGATACTCGAGTATCTGTTTCCAGACGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-1151s1c1
Sequence:CCGGGAGTTACAGTGCCAAGATGAACTCGAGTTCATCTTGGCACTGTAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194109.2-2705s1c1
Sequence:CCGGGTGGCGAAGGAATTACAACAACTCGAGTTGTTGTAATTCCTTCGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)