EMAIL THIS PAGE TO A FRIEND

IGSF5

immunoglobulin superfamily, member 5

82 Gene Product Result for
Synonyms: GSF5 JAM4
UniProtKB ID: Q9NSI5
Gene ID:
Mouse(72058) immunoglobulin superfamily, member 5
Rat(304000) immunoglobulin superfamily, member 5
domestic guinea pig(100724813) immunoglobulin superfamily, member 5
naked mole-rat(101711008) immunoglobulin superfamily, member 5
sheep(101123596) immunoglobulin superfamily, member 5
Zebrafish(561211) immunoglobulin superfamily, member 5
chicken(418524) immunoglobulin superfamily, member 5
cow(511594) immunoglobulin superfamily, member 5
domestic cat(101097753) immunoglobulin superfamily, member 5
dog(610716) immunoglobulin superfamily, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080444 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050211 MISSION® esiRNA esiRNA human IGSF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080444 Rosetta Predictions human pricing
XM_086761 Rosetta Predictions human pricing
XM_932799 Rosetta Predictions human pricing
XM_932803 Rosetta Predictions human pricing
NM_001006990 Rosetta Predictions rat pricing
XM_579163 Rosetta Predictions rat pricing
NM_028078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314906 predicted 1616
2 SASI_Hs02_00314907 predicted 1545
3 SASI_Hs02_00314908 predicted 489
4 SASI_Hs02_00314909 predicted 1726
5 SASI_Hs02_00314910 predicted 1455
6 SASI_Hs02_00314911 predicted 1449
7 SASI_Hs02_00314912 predicted 566
8 SASI_Hs02_00314913 predicted 1452
9 SASI_Hs02_00314914 predicted 728
10 SASI_Hs02_00314915 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_086761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271032 predicted 1621
2 SASI_Hs01_00271033 predicted 1299
3 SASI_Hs01_00271034 predicted 1543
4 SASI_Hs01_00271035 predicted 1690
5 SASI_Hs01_00271036 predicted 487
6 SASI_Hs01_00271037 predicted 1721
7 SASI_Hs01_00271038 predicted 561
8 SASI_Hs01_00271039 predicted 1452
9 SASI_Hs01_00271040 predicted 572
10 SASI_Hs01_00271041 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277553 predicted 1935
2 SASI_Hs01_00277554 predicted 1615
3 SASI_Hs01_00277555 predicted 1859
4 SASI_Hs01_00277556 predicted 2002
5 SASI_Hs01_00277557 predicted 801
6 SASI_Hs01_00277558 predicted 2040
7 SASI_Hs01_00277559 predicted 871
8 SASI_Hs01_00277560 predicted 1756
9 SASI_Hs01_00277561 predicted 876
10 SASI_Hs01_00277562 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298693 predicted 934
2 SASI_Hs01_00298694 predicted 479
3 SASI_Hs01_00298695 predicted 887
4 SASI_Hs01_00298696 predicted 925
5 SASI_Hs01_00298697 predicted 616
6 SASI_Hs01_00298698 predicted 440
7 SASI_Hs01_00298699 predicted 862
8 SASI_Hs01_00298700 predicted 1041
9 SASI_Hs01_00298701 predicted 494
10 SASI_Hs01_00298702 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106357 predicted 1196
2 SASI_Rn01_00106358 predicted 429
3 SASI_Rn01_00106359 predicted 636
4 SASI_Rn01_00106360 predicted 1458
5 SASI_Rn01_00106362 predicted 1166
6 SASI_Rn01_00106363 predicted 1126
7 SASI_Rn01_00106364 predicted 1443
8 SASI_Rn02_00198565 predicted 717
9 SASI_Rn01_00106365 predicted 752
10 SASI_Rn01_00106366 predicted 497
11 SASI_Rn01_00106361 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169897 predicted 269
2 SASI_Rn01_00169898 predicted 292
3 SASI_Rn01_00169899 predicted 442
4 SASI_Rn01_00169900 predicted 399
5 SASI_Rn01_00169901 predicted 437
6 SASI_Rn01_00169902 predicted 418
7 SASI_Rn01_00169903 predicted 284
8 SASI_Rn01_00169904 predicted 349
9 SASI_Rn01_00169905 predicted 456
10 SASI_Rn01_00169906 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060837 predicted 739
2 SASI_Mm01_00060838 predicted 580
3 SASI_Mm01_00060839 predicted 1021
4 SASI_Mm01_00060840 predicted 732
5 SASI_Mm01_00060841 predicted 1170
6 SASI_Mm01_00060842 predicted 327
7 SASI_Mm01_00060843 predicted 481
8 SASI_Mm01_00060844 predicted 677
9 SASI_Mm01_00060845 predicted 1015
10 SASI_Mm01_00060846 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028078
VALIDATED
IGSF5 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028078.1-1034s1c1
Sequence:CCGGCCCTGTATTCCAAGAAGTATTCTCGAGAATACTTCTTGGAATACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028078.1-777s1c1
Sequence:CCGGCCTTCCTTATCAGGAACTCAACTCGAGTTGAGTTCCTGATAAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028078.1-1035s1c2
Sequence:CCGGCCTGTATTCCAAGAAGTATTTCTCGAGAAATACTTCTTGGAATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028078.2-303s21c1
Sequence:CCGGCGCTTCACCTATGCCAGTTACCTCGAGGTAACTGGCATAGGTGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-865s21c1
Sequence:CCGGGAAATGTGACTTTAGTGTAATCTCGAGATTACACTAAAGTCACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028078.2-991s21c1
Sequence:CCGGTCACCGGAGCTGATGGTTAATCTCGAGATTAACCATCAGCTCCGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-230s21c1
Sequence:CCGGGCTTCTCATGTGGACTCTTAACTCGAGTTAAGAGTCCACATGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-126s21c1
Sequence:CCGGACAGCTTCCGGATCCAGTTATCTCGAGATAACTGGATCCGGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028078
VALIDATED
IGSF5 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028078.1-1034s1c1
Sequence:CCGGCCCTGTATTCCAAGAAGTATTCTCGAGAATACTTCTTGGAATACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028078.1-777s1c1
Sequence:CCGGCCTTCCTTATCAGGAACTCAACTCGAGTTGAGTTCCTGATAAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028078.1-1035s1c2
Sequence:CCGGCCTGTATTCCAAGAAGTATTTCTCGAGAAATACTTCTTGGAATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028078.2-303s21c1
Sequence:CCGGCGCTTCACCTATGCCAGTTACCTCGAGGTAACTGGCATAGGTGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-865s21c1
Sequence:CCGGGAAATGTGACTTTAGTGTAATCTCGAGATTACACTAAAGTCACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028078.2-991s21c1
Sequence:CCGGTCACCGGAGCTGATGGTTAATCTCGAGATTAACCATCAGCTCCGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-230s21c1
Sequence:CCGGGCTTCTCATGTGGACTCTTAACTCGAGTTAAGAGTCCACATGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-126s21c1
Sequence:CCGGACAGCTTCCGGATCCAGTTATCTCGAGATAACTGGATCCGGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028078
VALIDATED
IGSF5 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028078.1-1034s1c1
Sequence:CCGGCCCTGTATTCCAAGAAGTATTCTCGAGAATACTTCTTGGAATACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028078.1-777s1c1
Sequence:CCGGCCTTCCTTATCAGGAACTCAACTCGAGTTGAGTTCCTGATAAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028078.1-1035s1c2
Sequence:CCGGCCTGTATTCCAAGAAGTATTTCTCGAGAAATACTTCTTGGAATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028078.2-303s21c1
Sequence:CCGGCGCTTCACCTATGCCAGTTACCTCGAGGTAACTGGCATAGGTGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-865s21c1
Sequence:CCGGGAAATGTGACTTTAGTGTAATCTCGAGATTACACTAAAGTCACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028078.2-991s21c1
Sequence:CCGGTCACCGGAGCTGATGGTTAATCTCGAGATTAACCATCAGCTCCGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-230s21c1
Sequence:CCGGGCTTCTCATGTGGACTCTTAACTCGAGTTAAGAGTCCACATGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028078.2-126s21c1
Sequence:CCGGACAGCTTCCGGATCCAGTTATCTCGAGATAACTGGATCCGGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080444
IGSF5 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-201s21c1
Sequence:CCGGACGGTTCTGGGTCTGGTAATGCTCGAGCATTACCAGACCCAGAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-820s21c1
Sequence:CCGGAGACACTGGAGGTGGTATTAACTCGAGTTAATACCACCTCCAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-647s21c1
Sequence:CCGGGTCAGCCATTCAAGCTATTATCTCGAGATAATAGCTTGAATGGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-854s21c1
Sequence:CCGGTTATCAAGTTTACCGAGTTTACTCGAGTAAACTCGGTAAACTTGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080444.1-1744s21c1
Sequence:CCGGTATCAGTGAAATACGAGTATACTCGAGTATACTCGTATTTCACTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080444
IGSF5 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-201s21c1
Sequence:CCGGACGGTTCTGGGTCTGGTAATGCTCGAGCATTACCAGACCCAGAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-820s21c1
Sequence:CCGGAGACACTGGAGGTGGTATTAACTCGAGTTAATACCACCTCCAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-647s21c1
Sequence:CCGGGTCAGCCATTCAAGCTATTATCTCGAGATAATAGCTTGAATGGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-854s21c1
Sequence:CCGGTTATCAAGTTTACCGAGTTTACTCGAGTAAACTCGGTAAACTTGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080444.1-1744s21c1
Sequence:CCGGTATCAGTGAAATACGAGTATACTCGAGTATACTCGTATTTCACTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080444
IGSF5 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-201s21c1
Sequence:CCGGACGGTTCTGGGTCTGGTAATGCTCGAGCATTACCAGACCCAGAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-820s21c1
Sequence:CCGGAGACACTGGAGGTGGTATTAACTCGAGTTAATACCACCTCCAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-647s21c1
Sequence:CCGGGTCAGCCATTCAAGCTATTATCTCGAGATAATAGCTTGAATGGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080444.1-854s21c1
Sequence:CCGGTTATCAAGTTTACCGAGTTTACTCGAGTAAACTCGGTAAACTTGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080444.1-1744s21c1
Sequence:CCGGTATCAGTGAAATACGAGTATACTCGAGTATACTCGTATTTCACTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)