EMAIL THIS PAGE TO A FRIEND

IGSF6

immunoglobulin superfamily, member 6

57 Gene Product Result for
Synonyms: DORA
UniProtKB ID: O95976, Q8WWD8
Gene ID:
Mouse(80719) immunoglobulin superfamily, member 6
Rat(171064) immunoglobulin superfamily, member 6
chicken(771906) immunoglobulin superfamily, member 6
cow(100140740) immunoglobulin superfamily, member 6
dog(100684869) immunoglobulin superfamily, member 6
sheep(101104452) immunoglobulin superfamily, member 6
domestic guinea pig(100720095) immunoglobulin superfamily, member 6
naked mole-rat(101713628) immunoglobulin superfamily, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005849 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025701 MISSION® esiRNA esiRNA human IGSF6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005849 Rosetta Predictions human pricing
NM_133542 Rosetta Predictions rat pricing
NM_030691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340395 predicted 378
2 SASI_Hs01_00023794 predicted 488
3 SASI_Hs01_00023795 predicted 354
4 SASI_Hs01_00023796 predicted 302
5 SASI_Hs01_00023797 predicted 454
6 SASI_Hs01_00023798 predicted 506
7 SASI_Hs01_00023799 predicted 439
8 SASI_Hs01_00023800 predicted 378
9 SASI_Hs01_00023801 predicted 637
10 SASI_Hs02_00340396 predicted 535
11 SASI_Hs01_00023793 predicted 350
12 SASI_Hs01_00023802 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031801 predicted 373
2 SASI_Rn01_00031802 predicted 516
3 SASI_Rn01_00031803 predicted 440
4 SASI_Rn01_00031804 predicted 410
5 SASI_Rn01_00031805 predicted 794
6 SASI_Rn01_00031806 predicted 353
7 SASI_Rn01_00031807 predicted 770
8 SASI_Rn01_00031808 predicted 537
9 SASI_Rn01_00031809 predicted 675
10 SASI_Rn01_00031810 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036450 predicted 474
2 SASI_Mm01_00036451 predicted 314
3 SASI_Mm01_00036452 predicted 355
4 SASI_Mm01_00036453 predicted 427
5 SASI_Mm01_00036454 predicted 810
6 SASI_Mm01_00036455 predicted 343
7 SASI_Mm01_00036456 predicted 791
8 SASI_Mm01_00036458 predicted 774
9 SASI_Mm01_00036459 predicted 359
10 SASI_Mm02_00336857 predicted 269
11 SASI_Mm01_00036457 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030691
IGSF6 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030691.1-371s21c1
Sequence:CCGGTACATCTGTGGAATAGCATTTCTCGAGAAATGCTATTCCACAGATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030691.1-398s21c1
Sequence:CCGGGAACTGTCACCAAGCGCTAAACTCGAGTTTAGCGCTTGGTGACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030691.1-1103s21c1
Sequence:CCGGCATAAGTAGCTGTCACTAATTCTCGAGAATTAGTGACAGCTACTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-441s1c1
Sequence:CCGGTGGTGGTAAGAGAAAGACTTTCTCGAGAAAGTCTTTCTCTTACCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-614s1c1
Sequence:CCGGCGGCGTATCTTTCAGGAAATTCTCGAGAATTTCCTGAAAGATACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-579s1c1
Sequence:CCGGGCAGAGAAACCAAAGGCTCAACTCGAGTTGAGCCTTTGGTTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-209s1c1
Sequence:CCGGCCACCAAAGAGCTTGTGGTTTCTCGAGAAACCACAAGCTCTTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-284s1c1
Sequence:CCGGGCAGACAAGTTCACAGTGAAACTCGAGTTTCACTGTGAACTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030691
IGSF6 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030691.1-371s21c1
Sequence:CCGGTACATCTGTGGAATAGCATTTCTCGAGAAATGCTATTCCACAGATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030691.1-398s21c1
Sequence:CCGGGAACTGTCACCAAGCGCTAAACTCGAGTTTAGCGCTTGGTGACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030691.1-1103s21c1
Sequence:CCGGCATAAGTAGCTGTCACTAATTCTCGAGAATTAGTGACAGCTACTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-441s1c1
Sequence:CCGGTGGTGGTAAGAGAAAGACTTTCTCGAGAAAGTCTTTCTCTTACCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-614s1c1
Sequence:CCGGCGGCGTATCTTTCAGGAAATTCTCGAGAATTTCCTGAAAGATACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-579s1c1
Sequence:CCGGGCAGAGAAACCAAAGGCTCAACTCGAGTTGAGCCTTTGGTTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-209s1c1
Sequence:CCGGCCACCAAAGAGCTTGTGGTTTCTCGAGAAACCACAAGCTCTTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-284s1c1
Sequence:CCGGGCAGACAAGTTCACAGTGAAACTCGAGTTTCACTGTGAACTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030691
IGSF6 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030691.1-371s21c1
Sequence:CCGGTACATCTGTGGAATAGCATTTCTCGAGAAATGCTATTCCACAGATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030691.1-398s21c1
Sequence:CCGGGAACTGTCACCAAGCGCTAAACTCGAGTTTAGCGCTTGGTGACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030691.1-1103s21c1
Sequence:CCGGCATAAGTAGCTGTCACTAATTCTCGAGAATTAGTGACAGCTACTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-441s1c1
Sequence:CCGGTGGTGGTAAGAGAAAGACTTTCTCGAGAAAGTCTTTCTCTTACCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-614s1c1
Sequence:CCGGCGGCGTATCTTTCAGGAAATTCTCGAGAATTTCCTGAAAGATACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-579s1c1
Sequence:CCGGGCAGAGAAACCAAAGGCTCAACTCGAGTTGAGCCTTTGGTTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-209s1c1
Sequence:CCGGCCACCAAAGAGCTTGTGGTTTCTCGAGAAACCACAAGCTCTTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030691.1-284s1c1
Sequence:CCGGGCAGACAAGTTCACAGTGAAACTCGAGTTTCACTGTGAACTTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005849
IGSF6 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005849.2-640s21c1
Sequence:CCGGAGAAGAGTGCTCGGCGTATTTCTCGAGAAATACGCCGAGCACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005849.2-672s21c1
Sequence:CCGGGCTCAAGAACTATACCATAAGCTCGAGCTTATGGTATAGTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005849.2-846s21c1
Sequence:CCGGCATATATCATCAGGTCTTAAACTCGAGTTTAAGACCTGATGATATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-590s1c1
Sequence:CCGGCCCTCTAAGAAAGAAAGAAATCTCGAGATTTCTTTCTTTCTTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-384s1c1
Sequence:CCGGGCAATTTACATCTGTGGAATACTCGAGTATTCCACAGATGTAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-182s1c1
Sequence:CCGGCGTCACCATAAAGTGTACCTTCTCGAGAAGGTACACTTTATGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-502s1c1
Sequence:CCGGGCTTCCTGACAGCTCTTGTATCTCGAGATACAAGAGCTGTCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-83s1c1
Sequence:CCGGGCAAACCAATCTCATTCTATTCTCGAGAATAGAATGAGATTGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005849
IGSF6 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005849.2-640s21c1
Sequence:CCGGAGAAGAGTGCTCGGCGTATTTCTCGAGAAATACGCCGAGCACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005849.2-672s21c1
Sequence:CCGGGCTCAAGAACTATACCATAAGCTCGAGCTTATGGTATAGTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005849.2-846s21c1
Sequence:CCGGCATATATCATCAGGTCTTAAACTCGAGTTTAAGACCTGATGATATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-590s1c1
Sequence:CCGGCCCTCTAAGAAAGAAAGAAATCTCGAGATTTCTTTCTTTCTTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-384s1c1
Sequence:CCGGGCAATTTACATCTGTGGAATACTCGAGTATTCCACAGATGTAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-182s1c1
Sequence:CCGGCGTCACCATAAAGTGTACCTTCTCGAGAAGGTACACTTTATGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-502s1c1
Sequence:CCGGGCTTCCTGACAGCTCTTGTATCTCGAGATACAAGAGCTGTCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-83s1c1
Sequence:CCGGGCAAACCAATCTCATTCTATTCTCGAGAATAGAATGAGATTGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005849
IGSF6 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005849.2-640s21c1
Sequence:CCGGAGAAGAGTGCTCGGCGTATTTCTCGAGAAATACGCCGAGCACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005849.2-672s21c1
Sequence:CCGGGCTCAAGAACTATACCATAAGCTCGAGCTTATGGTATAGTTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005849.2-846s21c1
Sequence:CCGGCATATATCATCAGGTCTTAAACTCGAGTTTAAGACCTGATGATATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-590s1c1
Sequence:CCGGCCCTCTAAGAAAGAAAGAAATCTCGAGATTTCTTTCTTTCTTAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-384s1c1
Sequence:CCGGGCAATTTACATCTGTGGAATACTCGAGTATTCCACAGATGTAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-182s1c1
Sequence:CCGGCGTCACCATAAAGTGTACCTTCTCGAGAAGGTACACTTTATGGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-502s1c1
Sequence:CCGGGCTTCCTGACAGCTCTTGTATCTCGAGATACAAGAGCTGTCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005849.1-83s1c1
Sequence:CCGGGCAAACCAATCTCATTCTATTCTCGAGAATAGAATGAGATTGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)