EMAIL THIS PAGE TO A FRIEND

IGSF8

immunoglobulin superfamily, member 8

49 Gene Product Result for
Synonyms: CD316 CD81P3 EWI-2 EWI2 KCT-4 LIR-D1 PGRL
UniProtKB ID: Q969P0, Q8NG09, Q96DP4, Q9BTG9
Gene ID:
Human(93185) Summary: This gene encodes a member the EWI subfamily of the immunoglobulin protein superfamily. Members of this family contain a single transmembrane domain, an EWI (Glu-Trp-Ile)-motif and a variable number of immunoglobulin domains. This protein interacts with the tetraspanins CD81 and CD9 and may regulate their role in certain cellular functions including cell migration and viral infection. The encoded protein may also function as a tumor suppressor by inhibiting the proliferation of certain cancers. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Mouse(140559) immunoglobulin superfamily, member 8
Rat(304979) immunoglobulin superfamily, member 8
domestic guinea pig(100721506) immunoglobulin superfamily, member 8
naked mole-rat(101721418) immunoglobulin superfamily, member 8
sheep(101102283) immunoglobulin superfamily, member 8
Domestic Rabbit(100338663) immunoglobulin superfamily, member 8
Horse(100058209) immunoglobulin superfamily, member 8
cow(519266) immunoglobulin superfamily, member 8
dog(100855523) immunoglobulin superfamily, member 8
domestic cat(101097041) immunoglobulin superfamily, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052868 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052868 Rosetta Predictions human pricing
NM_001014787 Rosetta Predictions rat pricing
NM_080419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208153 predicted 1112
2 SASI_Hs01_00208154 predicted 839
3 SASI_Hs01_00208155 predicted 1918
4 SASI_Hs01_00208157 predicted 2004
5 SASI_Hs01_00208158 predicted 1263
6 SASI_Hs01_00208159 predicted 1153
7 SASI_Hs01_00208160 predicted 1169
8 SASI_Hs01_00208161 predicted 1313
9 SASI_Hs02_00361567 predicted 562
10 SASI_Hs01_00208162 predicted 659
11 SASI_Hs01_00208156 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072444 predicted 246
2 SASI_Rn01_00072445 predicted 644
3 SASI_Rn02_00201898 predicted 1888
4 SASI_Rn01_00072446 predicted 1029
5 SASI_Rn01_00072447 predicted 279
6 SASI_Rn01_00072448 predicted 649
7 SASI_Rn01_00072449 predicted 1930
8 SASI_Rn01_00072450 predicted 647
9 SASI_Rn01_00072451 predicted 811
10 SASI_Rn01_00072453 predicted 1716
11 SASI_Rn01_00072452 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113385 predicted 296
2 SASI_Mm01_00113386 predicted 328
3 SASI_Mm01_00113387 predicted 862
4 SASI_Mm01_00113388 predicted 1075
5 SASI_Mm01_00113389 predicted 1845
6 SASI_Mm01_00113390 predicted 1136
7 SASI_Mm02_00338084 predicted 368
8 SASI_Mm01_00113391 predicted 436
9 SASI_Mm01_00113393 predicted 1123
10 SASI_Mm01_00113394 predicted 1497
11 SASI_Mm01_00113392 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080419
VALIDATED
IGSF8 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080419.1-1084s1c1
Sequence:CCGGCCCTTAGAACTGCTGTGCAATCTCGAGATTGCACAGCAGTTCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1931s1c1
Sequence:CCGGCCTGCTGCTTTATGAAGAGGACTCGAGTCCTCTTCATAAAGCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080419.1-265s1c1
Sequence:CCGGTCCTGCAACGTGAGTGACTATCTCGAGATAGTCACTCACGTTGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1496s1c1
Sequence:CCGGCCTCCCTGCTATGCAACATATCTCGAGATATGTTGCATAGCAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1728s1c1
Sequence:CCGGGCCTGAGGATGAAGGCATATACTCGAGTATATGCCTTCATCCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1496s21c1
Sequence:CCGGCCTCCCTGCTATGCAACATATCTCGAGATATGTTGCATAGCAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-265s21c1
Sequence:CCGGTCCTGCAACGTGAGTGACTATCTCGAGATAGTCACTCACGTTGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1084s21c1
Sequence:CCGGCCCTTAGAACTGCTGTGCAATCTCGAGATTGCACAGCAGTTCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1728s21c1
Sequence:CCGGGCCTGAGGATGAAGGCATATACTCGAGTATATGCCTTCATCCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080419
VALIDATED
IGSF8 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080419.1-1084s1c1
Sequence:CCGGCCCTTAGAACTGCTGTGCAATCTCGAGATTGCACAGCAGTTCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1931s1c1
Sequence:CCGGCCTGCTGCTTTATGAAGAGGACTCGAGTCCTCTTCATAAAGCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080419.1-265s1c1
Sequence:CCGGTCCTGCAACGTGAGTGACTATCTCGAGATAGTCACTCACGTTGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1496s1c1
Sequence:CCGGCCTCCCTGCTATGCAACATATCTCGAGATATGTTGCATAGCAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1728s1c1
Sequence:CCGGGCCTGAGGATGAAGGCATATACTCGAGTATATGCCTTCATCCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1496s21c1
Sequence:CCGGCCTCCCTGCTATGCAACATATCTCGAGATATGTTGCATAGCAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-265s21c1
Sequence:CCGGTCCTGCAACGTGAGTGACTATCTCGAGATAGTCACTCACGTTGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1084s21c1
Sequence:CCGGCCCTTAGAACTGCTGTGCAATCTCGAGATTGCACAGCAGTTCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1728s21c1
Sequence:CCGGGCCTGAGGATGAAGGCATATACTCGAGTATATGCCTTCATCCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080419
VALIDATED
IGSF8 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080419.1-1084s1c1
Sequence:CCGGCCCTTAGAACTGCTGTGCAATCTCGAGATTGCACAGCAGTTCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1931s1c1
Sequence:CCGGCCTGCTGCTTTATGAAGAGGACTCGAGTCCTCTTCATAAAGCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080419.1-265s1c1
Sequence:CCGGTCCTGCAACGTGAGTGACTATCTCGAGATAGTCACTCACGTTGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1496s1c1
Sequence:CCGGCCTCCCTGCTATGCAACATATCTCGAGATATGTTGCATAGCAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080419.1-1728s1c1
Sequence:CCGGGCCTGAGGATGAAGGCATATACTCGAGTATATGCCTTCATCCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1496s21c1
Sequence:CCGGCCTCCCTGCTATGCAACATATCTCGAGATATGTTGCATAGCAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-265s21c1
Sequence:CCGGTCCTGCAACGTGAGTGACTATCTCGAGATAGTCACTCACGTTGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1084s21c1
Sequence:CCGGCCCTTAGAACTGCTGTGCAATCTCGAGATTGCACAGCAGTTCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080419.1-1728s21c1
Sequence:CCGGGCCTGAGGATGAAGGCATATACTCGAGTATATGCCTTCATCCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052868
IGSF8 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-409s1c1
Sequence:CCGGCCAGTTCTCCTATGCTGTCTTCTCGAGAAGACAGCATAGGAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1947s1c1
Sequence:CCGGCTGTCCTTGGTACCATCACTTCTCGAGAAGTGATGGTACCAAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-205s1c1
Sequence:CCGGGCTGCTGCTAATGCTAGGAATCTCGAGATTCCTAGCATTAGCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1971s1c1
Sequence:CCGGGCTTCATGAAGAGGCTTCGAACTCGAGTTCGAAGCCTCTTCATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1448s1c1
Sequence:CCGGCCTGTACATGTGCGGGAGGAACTCGAGTTCCTCCCGCACATGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052868.2-1370s21c1
Sequence:CCGGTGCCTCGCCAAAGCCTATGTTCTCGAGAACATAGGCTTTGGCGAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052868
IGSF8 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-409s1c1
Sequence:CCGGCCAGTTCTCCTATGCTGTCTTCTCGAGAAGACAGCATAGGAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1947s1c1
Sequence:CCGGCTGTCCTTGGTACCATCACTTCTCGAGAAGTGATGGTACCAAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-205s1c1
Sequence:CCGGGCTGCTGCTAATGCTAGGAATCTCGAGATTCCTAGCATTAGCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1971s1c1
Sequence:CCGGGCTTCATGAAGAGGCTTCGAACTCGAGTTCGAAGCCTCTTCATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1448s1c1
Sequence:CCGGCCTGTACATGTGCGGGAGGAACTCGAGTTCCTCCCGCACATGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052868.2-1370s21c1
Sequence:CCGGTGCCTCGCCAAAGCCTATGTTCTCGAGAACATAGGCTTTGGCGAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052868
IGSF8 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-409s1c1
Sequence:CCGGCCAGTTCTCCTATGCTGTCTTCTCGAGAAGACAGCATAGGAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1947s1c1
Sequence:CCGGCTGTCCTTGGTACCATCACTTCTCGAGAAGTGATGGTACCAAGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-205s1c1
Sequence:CCGGGCTGCTGCTAATGCTAGGAATCTCGAGATTCCTAGCATTAGCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1971s1c1
Sequence:CCGGGCTTCATGAAGAGGCTTCGAACTCGAGTTCGAAGCCTCTTCATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052868.1-1448s1c1
Sequence:CCGGCCTGTACATGTGCGGGAGGAACTCGAGTTCCTCCCGCACATGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052868.2-1370s21c1
Sequence:CCGGTGCCTCGCCAAAGCCTATGTTCTCGAGAACATAGGCTTTGGCGAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)