EMAIL THIS PAGE TO A FRIEND

IGSF9

immunoglobulin superfamily, member 9

46 Gene Product Result for
Synonyms: FP18798 IGSF9A Nrt1
UniProtKB ID: Q9P2J2
Gene ID:
Mouse(93842) immunoglobulin superfamily, member 9
Rat(304982) immunoglobulin superfamily, member 9
Zebrafish(557459) immunoglobulin superfamily, member 9-like
cow(504209) immunoglobulin superfamily, member 9
dog(488634) immunoglobulin superfamily, member 9
domestic cat(101097785) immunoglobulin superfamily, member 9
chicken(425454) immunoglobulin superfamily, member 9
sheep(101116526) immunoglobulin superfamily, member 9
Domestic Rabbit(100346549) immunoglobulin superfamily, member 9
domestic guinea pig(100728219) immunoglobulin superfamily, member 9
naked mole-rat(101725469) immunoglobulin superfamily, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101143 Anti-IGSF9 antibody produced in rabbit affinity isolated antibody rat, human, rabbit, guinea pig, horse, mouse
western blot pricing
HPA037753 Anti-IGSF9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020789 Rosetta Predictions human pricing
NM_001107197 Rosetta Predictions rat pricing
NM_033608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125944 predicted 1068
2 SASI_Hs01_00125945 predicted 1667
3 SASI_Hs01_00125946 predicted 2481
4 SASI_Hs01_00125947 predicted 1746
5 SASI_Hs02_00353946 predicted 3036
6 SASI_Hs01_00125948 predicted 2498
7 SASI_Hs01_00125949 predicted 3036
8 SASI_Hs01_00125950 predicted 1607
9 SASI_Hs01_00125951 predicted 3681
10 SASI_Hs01_00125952 predicted 2094
11 SASI_Hs01_00125953 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226465 predicted 539
2 SASI_Rn02_00226466 predicted 3281
3 SASI_Rn02_00226467 predicted 1912
4 SASI_Rn02_00226468 predicted 1372
5 SASI_Rn02_00226469 predicted 1195
6 SASI_Rn02_00226470 predicted 1070
7 SASI_Rn02_00226471 predicted 758
8 SASI_Rn02_00226472 predicted 1098
9 SASI_Rn02_00226473 predicted 2081
10 SASI_Rn02_00226474 predicted 2929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087066 predicted 1848
2 SASI_Mm01_00087068 predicted 1121
3 SASI_Mm01_00087069 predicted 1658
4 SASI_Mm02_00337467 predicted 745
5 SASI_Mm01_00087070 predicted 3576
6 SASI_Mm01_00087071 predicted 3177
7 SASI_Mm01_00087072 predicted 2102
8 SASI_Mm01_00087073 predicted 1512
9 SASI_Mm01_00087074 predicted 3236
10 SASI_Mm01_00087075 predicted 2376
11 SASI_Mm01_00087067 predicted 3309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020789
IGSF9 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-3389s21c1
Sequence:CCGGCATCTGTGGACGAGAACTATGCTCGAGCATAGTTCTCGTCCACAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-579s21c1
Sequence:CCGGGGTGCATCTGACAGTCAATTCCTCGAGGAATTGACTGTCAGATGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-1747s21c1
Sequence:CCGGGGTGGTTATCTGCAGAGATTCCTCGAGGAATCTCTGCAGATAACCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-895s1c1
Sequence:CCGGCCCAAGAACAGCACAGTCAATCTCGAGATTGACTGTGCTGTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-1669s1c1
Sequence:CCGGAGCCCTCATGTTGTCACCAATCTCGAGATTGGTGACAACATGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-2211s1c1
Sequence:CCGGCAAGGATGTTCTCTACGAGTTCTCGAGAACTCGTAGAGAACATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020789.2-3695s1c1
Sequence:CCGGCCCTAATGTGAGGCTGTGAAACTCGAGTTTCACAGCCTCACATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-3035s1c1
Sequence:CCGGCCACCTCATCTTTCCTTCGTTCTCGAGAACGAAGGAAAGATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020789
IGSF9 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-3389s21c1
Sequence:CCGGCATCTGTGGACGAGAACTATGCTCGAGCATAGTTCTCGTCCACAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-579s21c1
Sequence:CCGGGGTGCATCTGACAGTCAATTCCTCGAGGAATTGACTGTCAGATGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-1747s21c1
Sequence:CCGGGGTGGTTATCTGCAGAGATTCCTCGAGGAATCTCTGCAGATAACCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-895s1c1
Sequence:CCGGCCCAAGAACAGCACAGTCAATCTCGAGATTGACTGTGCTGTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-1669s1c1
Sequence:CCGGAGCCCTCATGTTGTCACCAATCTCGAGATTGGTGACAACATGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-2211s1c1
Sequence:CCGGCAAGGATGTTCTCTACGAGTTCTCGAGAACTCGTAGAGAACATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020789.2-3695s1c1
Sequence:CCGGCCCTAATGTGAGGCTGTGAAACTCGAGTTTCACAGCCTCACATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-3035s1c1
Sequence:CCGGCCACCTCATCTTTCCTTCGTTCTCGAGAACGAAGGAAAGATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020789
IGSF9 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-3389s21c1
Sequence:CCGGCATCTGTGGACGAGAACTATGCTCGAGCATAGTTCTCGTCCACAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-579s21c1
Sequence:CCGGGGTGCATCTGACAGTCAATTCCTCGAGGAATTGACTGTCAGATGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020789.3-1747s21c1
Sequence:CCGGGGTGGTTATCTGCAGAGATTCCTCGAGGAATCTCTGCAGATAACCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-895s1c1
Sequence:CCGGCCCAAGAACAGCACAGTCAATCTCGAGATTGACTGTGCTGTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-1669s1c1
Sequence:CCGGAGCCCTCATGTTGTCACCAATCTCGAGATTGGTGACAACATGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-2211s1c1
Sequence:CCGGCAAGGATGTTCTCTACGAGTTCTCGAGAACTCGTAGAGAACATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020789.2-3695s1c1
Sequence:CCGGCCCTAATGTGAGGCTGTGAAACTCGAGTTTCACAGCCTCACATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020789.2-3035s1c1
Sequence:CCGGCCACCTCATCTTTCCTTCGTTCTCGAGAACGAAGGAAAGATGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033608
VALIDATED
IGSF9 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-1933s21c1
Sequence:CCGGGAGATTCAGTGTCTGGTATACCTCGAGGTATACCAGACACTGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-1807s21c1
Sequence:CCGGGACCACTTCCACCAATGTATACTCGAGTATACATTGGTGGAAGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-2108s21c1
Sequence:CCGGAGTGAGATTGTCCTGTCTATACTCGAGTATAGACAGGACAATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-3863s21c1
Sequence:CCGGGCCCGCTTAGTGTGAAACTAACTCGAGTTAGTTTCACACTAAGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-2385s21c1
Sequence:CCGGAGGACGTTCTCTATGAGTTTCCTCGAGGAAACTCATAGAGAACGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-3863s1c1
Sequence:CCGGGCCCGCTTAGTGTGAAACTAACTCGAGTTAGTTTCACACTAAGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-2837s1c1
Sequence:CCGGCCCTTACCATTAGAGCCCATTCTCGAGAATGGGCTCTAATGGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-2838s1c1
Sequence:CCGGCCTTACCATTAGAGCCCATTTCTCGAGAAATGGGCTCTAATGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-3174s1c1
Sequence:CCGGCGCCTCCAGATTTCATGGATACTCGAGTATCCATGAAATCTGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033608.2-880s1c1
Sequence:CCGGGCAGAATGGAACACTGTGGATCTCGAGATCCACAGTGTTCCATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033608
VALIDATED
IGSF9 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-1933s21c1
Sequence:CCGGGAGATTCAGTGTCTGGTATACCTCGAGGTATACCAGACACTGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-1807s21c1
Sequence:CCGGGACCACTTCCACCAATGTATACTCGAGTATACATTGGTGGAAGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-2108s21c1
Sequence:CCGGAGTGAGATTGTCCTGTCTATACTCGAGTATAGACAGGACAATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-3863s21c1
Sequence:CCGGGCCCGCTTAGTGTGAAACTAACTCGAGTTAGTTTCACACTAAGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-2385s21c1
Sequence:CCGGAGGACGTTCTCTATGAGTTTCCTCGAGGAAACTCATAGAGAACGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-3863s1c1
Sequence:CCGGGCCCGCTTAGTGTGAAACTAACTCGAGTTAGTTTCACACTAAGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-2837s1c1
Sequence:CCGGCCCTTACCATTAGAGCCCATTCTCGAGAATGGGCTCTAATGGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-2838s1c1
Sequence:CCGGCCTTACCATTAGAGCCCATTTCTCGAGAAATGGGCTCTAATGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-3174s1c1
Sequence:CCGGCGCCTCCAGATTTCATGGATACTCGAGTATCCATGAAATCTGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033608.2-880s1c1
Sequence:CCGGGCAGAATGGAACACTGTGGATCTCGAGATCCACAGTGTTCCATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033608
VALIDATED
IGSF9 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-1933s21c1
Sequence:CCGGGAGATTCAGTGTCTGGTATACCTCGAGGTATACCAGACACTGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-1807s21c1
Sequence:CCGGGACCACTTCCACCAATGTATACTCGAGTATACATTGGTGGAAGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-2108s21c1
Sequence:CCGGAGTGAGATTGTCCTGTCTATACTCGAGTATAGACAGGACAATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-3863s21c1
Sequence:CCGGGCCCGCTTAGTGTGAAACTAACTCGAGTTAGTTTCACACTAAGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033608.3-2385s21c1
Sequence:CCGGAGGACGTTCTCTATGAGTTTCCTCGAGGAAACTCATAGAGAACGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-3863s1c1
Sequence:CCGGGCCCGCTTAGTGTGAAACTAACTCGAGTTAGTTTCACACTAAGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-2837s1c1
Sequence:CCGGCCCTTACCATTAGAGCCCATTCTCGAGAATGGGCTCTAATGGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-2838s1c1
Sequence:CCGGCCTTACCATTAGAGCCCATTTCTCGAGAAATGGGCTCTAATGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033608.2-3174s1c1
Sequence:CCGGCGCCTCCAGATTTCATGGATACTCGAGTATCCATGAAATCTGGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033608.2-880s1c1
Sequence:CCGGGCAGAATGGAACACTGTGGATCTCGAGATCCACAGTGTTCCATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)