EMAIL THIS PAGE TO A FRIEND

IGSF9B

immunoglobulin superfamily, member 9B

93 Gene Product Result for
UniProtKB ID: Q9UPX0
Gene ID:
Mouse(235086) immunoglobulin superfamily, member 9B
Rat(315510) immunoglobulin superfamily, member 9B
domestic guinea pig(100735756) immunoglobulin superfamily, member 9B
naked mole-rat(101705741) immunoglobulin superfamily, member 9B
sheep(101119518) immunoglobulin superfamily, member 9B
Zebrafish(553348) immunoglobulin superfamily, member 9b
cow(517432) immunoglobulin superfamily, member 9B
Horse(100072847) immunoglobulin superfamily, member 9B
domestic cat(101095043) immunoglobulin superfamily, member 9B
dog(489272) immunoglobulin superfamily, member 9B
chicken(428237) immunoglobulin superfamily, member 9B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014987 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094981 MISSION® esiRNA esiRNA human IGSF9B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014987 Rosetta Predictions human pricing
XM_290502 Rosetta Predictions human pricing
XM_001054496 Rosetta Predictions rat pricing
XM_235959 Rosetta Predictions rat pricing
NM_001033323 Rosetta Predictions mouse pricing
NM_001129787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346731 predicted 1837
2 SASI_Hs02_00346732 predicted 2029
3 SASI_Hs02_00346733 predicted 931
4 SASI_Hs02_00346734 predicted 1408
5 SASI_Hs02_00346735 predicted 3115
6 SASI_Hs02_00346736 predicted 3630
7 SASI_Hs02_00346737 predicted 398
8 SASI_Hs02_00346738 predicted 582
9 SASI_Hs02_00346739 predicted 3168
10 SASI_Hs02_00346740 predicted 2662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261585 predicted 1615
2 SASI_Hs01_00261586 predicted 1801
3 SASI_Hs01_00261587 predicted 705
4 SASI_Hs01_00261588 predicted 271
5 SASI_Hs01_00261589 predicted 1181
6 SASI_Hs01_00261590 predicted 2894
7 SASI_Hs01_00261591 predicted 3408
8 SASI_Hs01_00261592 predicted 175
9 SASI_Hs01_00261593 predicted 360
10 SASI_Hs01_00261594 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276015 predicted 581
2 SASI_Rn02_00276016 predicted 379
3 SASI_Rn02_00276017 predicted 225
4 SASI_Rn02_00276018 predicted 2417
5 SASI_Rn02_00276019 predicted 468
6 SASI_Rn02_00276020 predicted 2001
7 SASI_Rn02_00276021 predicted 1325
8 SASI_Rn02_00276022 predicted 1548
9 SASI_Rn02_00276023 predicted 1311
10 SASI_Rn02_00276024 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389765 predicted 585
2 SASI_Rn02_00389766 predicted 381
3 SASI_Rn02_00389767 predicted 227
4 SASI_Rn02_00389768 predicted 2418
5 SASI_Rn02_00389769 predicted 463
6 SASI_Rn02_00389770 predicted 1999
7 SASI_Rn02_00389771 predicted 1324
8 SASI_Rn02_00389772 predicted 1557
9 SASI_Rn02_00389773 predicted 1315
10 SASI_Rn02_00389774 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069802 predicted 839
2 SASI_Mm02_00288562 predicted 394
3 SASI_Mm01_00069806 predicted 1076
4 SASI_Mm01_00069807 predicted 1691
5 SASI_Mm01_00069808 predicted 920
6 SASI_Mm02_00288563 predicted 2018
7 SASI_Mm01_00069809 predicted 2013
8 SASI_Mm02_00288564 predicted 680
9 SASI_Mm02_00288565 predicted 353
10 SASI_Mm01_00069811 predicted 1401
11 SASI_Mm01_00069803 predicted 2418
12 SASI_Mm01_00069804 predicted 2393
13 SASI_Mm01_00069805 predicted 2349
14 SASI_Mm01_00069810 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310768 predicted 839
2 SASI_Mm02_00310769 predicted 391
3 SASI_Mm02_00310770 predicted 1080
4 SASI_Mm02_00310771 predicted 1691
5 SASI_Mm02_00310772 predicted 923
6 SASI_Mm02_00310773 predicted 2011
7 SASI_Mm02_00310774 predicted 681
8 SASI_Mm02_00310775 predicted 356
9 SASI_Mm02_00310776 predicted 1397
10 SASI_Mm02_00310777 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033323
IGSF9B MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 9B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-349s21c1
Sequence:CCGGGGTTCTGCGATGCGACGTAATCTCGAGATTACGTCGCATCGCAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-840s21c1
Sequence:CCGGCCTATACGTGTCGAGCATATACTCGAGTATATGCTCGACACGTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033323.3-2481s21c1
Sequence:CCGGTGTGTGTCTGCCCTACCATTTCTCGAGAAATGGTAGGGCAGACACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-614s21c1
Sequence:CCGGTGGGTCCATCTCACCATTAACCTCGAGGTTAATGGTGAGATGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-1238s21c1
Sequence:CCGGGTGGGAATCCATGGCTATATCCTCGAGGATATAGCCATGGATTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033323
IGSF9B MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 9B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-349s21c1
Sequence:CCGGGGTTCTGCGATGCGACGTAATCTCGAGATTACGTCGCATCGCAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-840s21c1
Sequence:CCGGCCTATACGTGTCGAGCATATACTCGAGTATATGCTCGACACGTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033323.3-2481s21c1
Sequence:CCGGTGTGTGTCTGCCCTACCATTTCTCGAGAAATGGTAGGGCAGACACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-614s21c1
Sequence:CCGGTGGGTCCATCTCACCATTAACCTCGAGGTTAATGGTGAGATGGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-1238s21c1
Sequence:CCGGGTGGGAATCCATGGCTATATCCTCGAGGATATAGCCATGGATTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033323
IGSF9B MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 9B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-349s21c1
Sequence:CCGGGGTTCTGCGATGCGACGTAATCTCGAGATTACGTCGCATCGCAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-840s21c1
Sequence:CCGGCCTATACGTGTCGAGCATATACTCGAGTATATGCTCGACACGTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033323.3-2481s21c1
Sequence:CCGGTGTGTGTCTGCCCTACCATTTCTCGAGAAATGGTAGGGCAGACACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-614s21c1
Sequence:CCGGTGGGTCCATCTCACCATTAACCTCGAGGTTAATGGTGAGATGGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033323.3-1238s21c1
Sequence:CCGGGTGGGAATCCATGGCTATATCCTCGAGGATATAGCCATGGATTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014987
IGSF9B MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 9B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-437s21c1
Sequence:CCGGTCCCTATCTTCATCAAGTTTGCTCGAGCAAACTTGATGAAGATAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014987.1-5592s21c1
Sequence:CCGGTTTACCATCTGTAGCTATAAACTCGAGTTTATAGCTACAGATGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-2030s21c1
Sequence:CCGGACACTTTAGCATTCCCTATTACTCGAGTAATAGGGAATGCTAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-1364s21c1
Sequence:CCGGAGGATGGCTCCATTCGAATTGCTCGAGCAATTCGAATGGAGCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014987
IGSF9B MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 9B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-437s21c1
Sequence:CCGGTCCCTATCTTCATCAAGTTTGCTCGAGCAAACTTGATGAAGATAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014987.1-5592s21c1
Sequence:CCGGTTTACCATCTGTAGCTATAAACTCGAGTTTATAGCTACAGATGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-2030s21c1
Sequence:CCGGACACTTTAGCATTCCCTATTACTCGAGTAATAGGGAATGCTAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-1364s21c1
Sequence:CCGGAGGATGGCTCCATTCGAATTGCTCGAGCAATTCGAATGGAGCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014987
IGSF9B MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 9B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-437s21c1
Sequence:CCGGTCCCTATCTTCATCAAGTTTGCTCGAGCAAACTTGATGAAGATAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014987.1-5592s21c1
Sequence:CCGGTTTACCATCTGTAGCTATAAACTCGAGTTTATAGCTACAGATGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-2030s21c1
Sequence:CCGGACACTTTAGCATTCCCTATTACTCGAGTAATAGGGAATGCTAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014987.1-1364s21c1
Sequence:CCGGAGGATGGCTCCATTCGAATTGCTCGAGCAATTCGAATGGAGCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)