EMAIL THIS PAGE TO A FRIEND

IHH

indian hedgehog

102 Gene Product Result for
Synonyms: BDA1 HHG2
UniProtKB ID: Q14623, B9EGM5, O43322, Q8N4B9
Gene ID:
Human(3549) Summary: This gene encodes a member of the hedgehog family of secreted signaling molecules. Hedgehog proteins are essential regulators of a variety of developmental processes including growth, patterning and morphogenesis. The encoded protein specifically plays a role in bone growth an differentiation. Mutations in this gene are the cause of brachydactyly type A1 which is characterized by shortening or malformation of the phalanges. Mutations in this gene are also the cause of acrocapitofemoral dysplasia. [provided by RefSeq, Feb 2010]
Mouse(16147) Indian hedgehog
Rat(84399) Indian hedgehog
chicken(395801) Indian hedgehog
dog(488533) Indian hedgehog
cow(522714) Indian hedgehog
Horse(100033984) Indian hedgehog
domestic cat(101100146) Indian hedgehog
sheep(101113658) Indian hedgehog
naked mole-rat(101697444) indian hedgehog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_050846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_050846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_050846 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002181 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003111 MISSION® esiRNA esiRNA targeting mouse Ihh (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002181 Rosetta Predictions human pricing
XM_001060415 Rosetta Predictions rat pricing
XM_576589 Rosetta Predictions rat pricing
NM_010544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059237 predicted 515
2 SASI_Hs01_00059238 predicted 418
3 SASI_Hs01_00059236 predicted 713
4 SASI_Hs01_00059240 predicted 325
5 SASI_Hs01_00059242 predicted 499
6 SASI_Hs02_00333392 predicted 1086
7 SASI_Hs02_00333393 predicted 1351
8 SASI_Hs02_00333394 predicted 1191
9 SASI_Hs02_00333395 predicted 1411
10 SASI_Hs02_00333396 predicted 1634
11 SASI_Hs01_00059239 predicted 826
12 SASI_Hs01_00059241 predicted 814
13 SASI_Hs01_00059243 predicted 301
14 SASI_Hs01_00059244 predicted 818
15 SASI_Hs01_00059245 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296444 predicted 1714
2 SASI_Rn02_00296445 predicted 2152
3 SASI_Rn02_00296446 predicted 2108
4 SASI_Rn02_00296447 predicted 1877
5 SASI_Rn02_00296448 predicted 578
6 SASI_Rn02_00296449 predicted 1881
7 SASI_Rn02_00296450 predicted 927
8 SASI_Rn02_00296451 predicted 1819
9 SASI_Rn02_00296452 predicted 1011
10 SASI_Rn02_00296453 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405597 predicted 1773
2 SASI_Rn02_00405598 predicted 1879
3 SASI_Rn02_00405599 predicted 1653
4 SASI_Rn02_00405600 predicted 1639
5 SASI_Rn02_00405601 predicted 1645
6 SASI_Rn02_00405602 predicted 1760
7 SASI_Rn02_00405603 predicted 1781
8 SASI_Rn02_00405604 predicted 1712
9 SASI_Rn02_00405605 predicted 1597
10 SASI_Rn02_00405606 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079304 predicted 2008
2 SASI_Mm01_00079305 predicted 1409
3 SASI_Mm01_00079306 predicted 2107
4 SASI_Mm02_00318794 predicted 1859
5 SASI_Mm01_00079307 predicted 2035
6 SASI_Mm01_00079308 predicted 1949
7 SASI_Mm01_00079309 predicted 1989
8 SASI_Mm01_00079310 predicted 1825
9 SASI_Mm01_00079311 predicted 988
10 SASI_Mm01_00079313 predicted 1198
11 SASI_Mm01_00079312 predicted 1849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_050846
IHH MISSION shRNA Bacterial Glycerol Stock
indian hedgehog
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-1089s1c1
Sequence:CCGGCCTGAGACTCTTTCACAGCTTCTCGAGAAGCTGTGAAAGAGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-716s1c1
Sequence:CCGGCCTTCAGCGATGTGCTCATTTCTCGAGAAATGAGCACATCGCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-826s1c1
Sequence:CCGGCTGCTCTTTACGGCTGACAATCTCGAGATTGTCAGCCGTAAAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-192s1c1
Sequence:CCGGCGGACGCTATGAAGGCAAGATCTCGAGATCTTGCCTTCATAGCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-477s1c1
Sequence:CCGGCCGCAATAAGTATGGACTGCTCTCGAGAGCAGTCCATACTTATTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_050846
IHH MISSION shRNA shRNA Plasmid DNA
indian hedgehog
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-1089s1c1
Sequence:CCGGCCTGAGACTCTTTCACAGCTTCTCGAGAAGCTGTGAAAGAGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-716s1c1
Sequence:CCGGCCTTCAGCGATGTGCTCATTTCTCGAGAAATGAGCACATCGCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-826s1c1
Sequence:CCGGCTGCTCTTTACGGCTGACAATCTCGAGATTGTCAGCCGTAAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-192s1c1
Sequence:CCGGCGGACGCTATGAAGGCAAGATCTCGAGATCTTGCCTTCATAGCGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-477s1c1
Sequence:CCGGCCGCAATAAGTATGGACTGCTCTCGAGAGCAGTCCATACTTATTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_050846
IHH MISSION shRNA Lentiviral Transduction Particles
indian hedgehog
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-1089s1c1
Sequence:CCGGCCTGAGACTCTTTCACAGCTTCTCGAGAAGCTGTGAAAGAGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-716s1c1
Sequence:CCGGCCTTCAGCGATGTGCTCATTTCTCGAGAAATGAGCACATCGCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-826s1c1
Sequence:CCGGCTGCTCTTTACGGCTGACAATCTCGAGATTGTCAGCCGTAAAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-192s1c1
Sequence:CCGGCGGACGCTATGAAGGCAAGATCTCGAGATCTTGCCTTCATAGCGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_050846.6-477s1c1
Sequence:CCGGCCGCAATAAGTATGGACTGCTCTCGAGAGCAGTCCATACTTATTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010544
VALIDATED
IHH MISSION shRNA Bacterial Glycerol Stock
indian hedgehog
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-1000s1c1
Sequence:CCGGGCTCTGTCAAGTCTGAGCATTCTCGAGAATGCTCAGACTTGACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-965s1c1
Sequence:CCGGCTGGGTGTATTACGAGTCCAACTCGAGTTGGACTCGTAATACACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010544.2-558s1c1
Sequence:CCGGCCTCGCAAGCTCGTGCCTCTTCTCGAGAAGAGGCACGAGCTTGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010544.2-1526s1c1
Sequence:CCGGCCTGCGACTGTTTCCCAGTTTCTCGAGAAACTGGGAAACAGTCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-1336s1c1
Sequence:CCGGCAGGCCAATATGTGCTGGTATCTCGAGATACCAGCACATATTGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010544
VALIDATED
IHH MISSION shRNA shRNA Plasmid DNA
indian hedgehog
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-1000s1c1
Sequence:CCGGGCTCTGTCAAGTCTGAGCATTCTCGAGAATGCTCAGACTTGACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-965s1c1
Sequence:CCGGCTGGGTGTATTACGAGTCCAACTCGAGTTGGACTCGTAATACACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010544.2-558s1c1
Sequence:CCGGCCTCGCAAGCTCGTGCCTCTTCTCGAGAAGAGGCACGAGCTTGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010544.2-1526s1c1
Sequence:CCGGCCTGCGACTGTTTCCCAGTTTCTCGAGAAACTGGGAAACAGTCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-1336s1c1
Sequence:CCGGCAGGCCAATATGTGCTGGTATCTCGAGATACCAGCACATATTGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010544
VALIDATED
IHH MISSION shRNA Lentiviral Transduction Particles
indian hedgehog
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-1000s1c1
Sequence:CCGGGCTCTGTCAAGTCTGAGCATTCTCGAGAATGCTCAGACTTGACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-965s1c1
Sequence:CCGGCTGGGTGTATTACGAGTCCAACTCGAGTTGGACTCGTAATACACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010544.2-558s1c1
Sequence:CCGGCCTCGCAAGCTCGTGCCTCTTCTCGAGAAGAGGCACGAGCTTGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010544.2-1526s1c1
Sequence:CCGGCCTGCGACTGTTTCCCAGTTTCTCGAGAAACTGGGAAACAGTCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010544.2-1336s1c1
Sequence:CCGGCAGGCCAATATGTGCTGGTATCTCGAGATACCAGCACATATTGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002181
IHH MISSION shRNA Bacterial Glycerol Stock
indian hedgehog
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000436856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002181.3-603s21c1
Sequence:CCGGACGTGCATTGCTCCGTCAAGTCTCGAGACTTGACGGAGCAATGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002181.3-303s21c1
Sequence:CCGGACAATCCAGACATCATCTTCACTCGAGTGAAGATGATGTCTGGATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002181.3-1655s21c1
Sequence:CCGGCTCAGTTGATGCTGCTAAATTCTCGAGAATTTAGCAGCATCAACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002181
IHH MISSION shRNA shRNA Plasmid DNA
indian hedgehog
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000436856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002181.3-603s21c1
Sequence:CCGGACGTGCATTGCTCCGTCAAGTCTCGAGACTTGACGGAGCAATGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002181.3-303s21c1
Sequence:CCGGACAATCCAGACATCATCTTCACTCGAGTGAAGATGATGTCTGGATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002181.3-1655s21c1
Sequence:CCGGCTCAGTTGATGCTGCTAAATTCTCGAGAATTTAGCAGCATCAACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002181
IHH MISSION shRNA Lentiviral Transduction Particles
indian hedgehog
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000436856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002181.3-603s21c1
Sequence:CCGGACGTGCATTGCTCCGTCAAGTCTCGAGACTTGACGGAGCAATGCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002181.3-303s21c1
Sequence:CCGGACAATCCAGACATCATCTTCACTCGAGTGAAGATGATGTCTGGATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002181.3-1655s21c1
Sequence:CCGGCTCAGTTGATGCTGCTAAATTCTCGAGAATTTAGCAGCATCAACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)