EMAIL THIS PAGE TO A FRIEND

IK

IK cytokine, down-regulator of HLA II

56 Gene Product Result for
Synonyms: CSA2 RED
UniProtKB ID: Q13123, Q6IPD8
Gene ID:
Human(3550) Summary: The protein encoded by this gene was identified by its RED repeat, a stretch of repeated arginine, glutamic acid and aspartic acid residues. The protein localizes to discrete dots within the nucleus, excluding the nucleolus. Its function is unknown. This gene maps to chromosome 5; however, a pseudogene may exist on chromosome 2. [provided by RefSeq, Jul 2008]
Mouse(24010) IK cytokine
Rat(291659) IK cytokine
Zebrafish(322241) IK cytokine
Horse(100072389) IK cytokine, down-regulator of HLA II
cow(100125318) IK cytokine, down-regulator of HLA II
domestic cat(101096631) IK cytokine, down-regulator of HLA II
chicken(416133) IK cytokine, down-regulator of HLA II
dog(607109) IK cytokine, down-regulator of HLA II
sheep(101119211) IK cytokine, down-regulator of HLA II
domestic guinea pig(100727434) IK cytokine, down-regulator of HLA II
naked mole-rat(101711119) IK cytokine, down-regulator of HLA II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006083 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006083 Rosetta Predictions human pricing
NM_001005537 Rosetta Predictions rat pricing
NM_011879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156368 predicted 783
2 SASI_Hs02_00340855 predicted 1561
3 SASI_Hs01_00156370 predicted 774
4 SASI_Hs02_00340856 predicted 634
5 SASI_Hs02_00340857 predicted 1607
6 SASI_Hs02_00340858 predicted 782
7 SASI_Hs02_00340859 predicted 1576
8 SASI_Hs01_00156371 predicted 732
9 SASI_Hs02_00340860 predicted 1702
10 SASI_Hs01_00156372 predicted 1459
11 SASI_Hs01_00156367 predicted 1539
12 SASI_Hs01_00156369 predicted 1491
13 SASI_Hs01_00156373 predicted 1470
14 SASI_Hs01_00156374 predicted 643
15 SASI_Hs01_00156375 predicted 1543
16 SASI_Hs01_00156376 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080209 predicted 1491
2 SASI_Rn01_00080211 predicted 1448
3 SASI_Rn01_00080212 predicted 866
4 SASI_Rn01_00080213 predicted 868
5 SASI_Rn01_00080214 predicted 930
6 SASI_Rn01_00080215 predicted 804
7 SASI_Rn01_00080216 predicted 1476
8 SASI_Rn01_00080217 predicted 783
9 SASI_Rn01_00080218 predicted 854
10 SASI_Rn02_00198391 predicted 931
11 SASI_Rn01_00080210 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075281 predicted 1680
2 SASI_Mm01_00075282 predicted 804
3 SASI_Mm01_00075283 predicted 920
4 SASI_Mm01_00075284 predicted 780
5 SASI_Mm01_00075285 predicted 1440
6 SASI_Mm01_00075286 predicted 930
7 SASI_Mm01_00075287 predicted 813
8 SASI_Mm01_00075288 predicted 634
9 SASI_Mm02_00321671 predicted 1774
10 SASI_Mm01_00075289 predicted 757
11 SASI_Mm01_00075290 predicted 1420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011879
VALIDATED
IK MISSION shRNA Bacterial Glycerol Stock
IK cytokine, down-regulator of HLA II
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-1758s1c1
Sequence:CCGGGCTGTTCTTAGTTGCTTGCTTCTCGAGAAGCAAGCAACTAAGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011879.1-411s1c1
Sequence:CCGGGCTGATAAGTACCACAGCCAACTCGAGTTGGCTGTGGTACTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-1606s1c1
Sequence:CCGGAGACGATTCAAAGAAACCAATCTCGAGATTGGTTTCTTTGAATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-769s1c1
Sequence:CCGGGCCTATGTAGTAGACCTGGATCTCGAGATCCAGGTCTACTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-697s1c1
Sequence:CCGGCGGAATGTGTATCGGATGCTTCTCGAGAAGCATCCGATACACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-829s21c1
Sequence:CCGGGCCTATGTAGTAGACCTGGATCTCGAGATCCAGGTCTACTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-1818s21c1
Sequence:CCGGGCTGTTCTTAGTTGCTTGCTTCTCGAGAAGCAAGCAACTAAGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-1410s21c1
Sequence:CCGGTAAGAAGCAGCTGGGCGATTTCTCGAGAAATCGCCCAGCTGCTTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-757s21c1
Sequence:CCGGCGGAATGTGTATCGGATGCTTCTCGAGAAGCATCCGATACACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-552s21c1
Sequence:CCGGGTTGATTCAGGAGTCCAAATTCTCGAGAATTTGGACTCCTGAATCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011879
VALIDATED
IK MISSION shRNA shRNA Plasmid DNA
IK cytokine, down-regulator of HLA II
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-1758s1c1
Sequence:CCGGGCTGTTCTTAGTTGCTTGCTTCTCGAGAAGCAAGCAACTAAGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011879.1-411s1c1
Sequence:CCGGGCTGATAAGTACCACAGCCAACTCGAGTTGGCTGTGGTACTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-1606s1c1
Sequence:CCGGAGACGATTCAAAGAAACCAATCTCGAGATTGGTTTCTTTGAATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-769s1c1
Sequence:CCGGGCCTATGTAGTAGACCTGGATCTCGAGATCCAGGTCTACTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-697s1c1
Sequence:CCGGCGGAATGTGTATCGGATGCTTCTCGAGAAGCATCCGATACACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-829s21c1
Sequence:CCGGGCCTATGTAGTAGACCTGGATCTCGAGATCCAGGTCTACTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-1818s21c1
Sequence:CCGGGCTGTTCTTAGTTGCTTGCTTCTCGAGAAGCAAGCAACTAAGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-1410s21c1
Sequence:CCGGTAAGAAGCAGCTGGGCGATTTCTCGAGAAATCGCCCAGCTGCTTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-757s21c1
Sequence:CCGGCGGAATGTGTATCGGATGCTTCTCGAGAAGCATCCGATACACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-552s21c1
Sequence:CCGGGTTGATTCAGGAGTCCAAATTCTCGAGAATTTGGACTCCTGAATCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011879
VALIDATED
IK MISSION shRNA Lentiviral Transduction Particles
IK cytokine, down-regulator of HLA II
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-1758s1c1
Sequence:CCGGGCTGTTCTTAGTTGCTTGCTTCTCGAGAAGCAAGCAACTAAGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011879.1-411s1c1
Sequence:CCGGGCTGATAAGTACCACAGCCAACTCGAGTTGGCTGTGGTACTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-1606s1c1
Sequence:CCGGAGACGATTCAAAGAAACCAATCTCGAGATTGGTTTCTTTGAATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-769s1c1
Sequence:CCGGGCCTATGTAGTAGACCTGGATCTCGAGATCCAGGTCTACTACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011879.1-697s1c1
Sequence:CCGGCGGAATGTGTATCGGATGCTTCTCGAGAAGCATCCGATACACATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-829s21c1
Sequence:CCGGGCCTATGTAGTAGACCTGGATCTCGAGATCCAGGTCTACTACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-1818s21c1
Sequence:CCGGGCTGTTCTTAGTTGCTTGCTTCTCGAGAAGCAAGCAACTAAGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-1410s21c1
Sequence:CCGGTAAGAAGCAGCTGGGCGATTTCTCGAGAAATCGCCCAGCTGCTTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-757s21c1
Sequence:CCGGCGGAATGTGTATCGGATGCTTCTCGAGAAGCATCCGATACACATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011879.2-552s21c1
Sequence:CCGGGTTGATTCAGGAGTCCAAATTCTCGAGAATTTGGACTCCTGAATCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006083
VALIDATED
IK MISSION shRNA Bacterial Glycerol Stock
IK cytokine, down-regulator of HLA II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-1566s1c1
Sequence:CCGGCCAGGAAGAATACAGCGAGTACTCGAGTACTCGCTGTATTCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-265s1c1
Sequence:CCGGCCTTCTAAGTCACGTCACCATCTCGAGATGGTGACGTGACTTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-1567s1c1
Sequence:CCGGCAGGAAGAATACAGCGAGTATCTCGAGATACTCGCTGTATTCTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-751s1c1
Sequence:CCGGCGCAATGTTTACCGAATGCTTCTCGAGAAGCATTCGGTAAACATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-752s1c1
Sequence:CCGGGCAATGTTTACCGAATGCTTTCTCGAGAAAGCATTCGGTAAACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-950s21c1
Sequence:CCGGCAAGCTGACCCAGATCCTTTCCTCGAGGAAAGGATCTGGGTCAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1044s21c1
Sequence:CCGGCCTGAGGCTGACATGAATATTCTCGAGAATATTCATGTCAGCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1703s21c1
Sequence:CCGGGTGGAAGAAGATTAGTGCAATCTCGAGATTGCACTAATCTTCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-469s21c1
Sequence:CCGGTCAGCACCACAGCTAACTATACTCGAGTATAGTTAGCTGTGGTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1314s21c1
Sequence:CCGGTCTACCAAGGAGTTGATCAAGCTCGAGCTTGATCAACTCCTTGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006083
VALIDATED
IK MISSION shRNA shRNA Plasmid DNA
IK cytokine, down-regulator of HLA II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-1566s1c1
Sequence:CCGGCCAGGAAGAATACAGCGAGTACTCGAGTACTCGCTGTATTCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-265s1c1
Sequence:CCGGCCTTCTAAGTCACGTCACCATCTCGAGATGGTGACGTGACTTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-1567s1c1
Sequence:CCGGCAGGAAGAATACAGCGAGTATCTCGAGATACTCGCTGTATTCTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-751s1c1
Sequence:CCGGCGCAATGTTTACCGAATGCTTCTCGAGAAGCATTCGGTAAACATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-752s1c1
Sequence:CCGGGCAATGTTTACCGAATGCTTTCTCGAGAAAGCATTCGGTAAACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-950s21c1
Sequence:CCGGCAAGCTGACCCAGATCCTTTCCTCGAGGAAAGGATCTGGGTCAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1044s21c1
Sequence:CCGGCCTGAGGCTGACATGAATATTCTCGAGAATATTCATGTCAGCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1703s21c1
Sequence:CCGGGTGGAAGAAGATTAGTGCAATCTCGAGATTGCACTAATCTTCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-469s21c1
Sequence:CCGGTCAGCACCACAGCTAACTATACTCGAGTATAGTTAGCTGTGGTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1314s21c1
Sequence:CCGGTCTACCAAGGAGTTGATCAAGCTCGAGCTTGATCAACTCCTTGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006083
VALIDATED
IK MISSION shRNA Lentiviral Transduction Particles
IK cytokine, down-regulator of HLA II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-1566s1c1
Sequence:CCGGCCAGGAAGAATACAGCGAGTACTCGAGTACTCGCTGTATTCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-265s1c1
Sequence:CCGGCCTTCTAAGTCACGTCACCATCTCGAGATGGTGACGTGACTTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-1567s1c1
Sequence:CCGGCAGGAAGAATACAGCGAGTATCTCGAGATACTCGCTGTATTCTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-751s1c1
Sequence:CCGGCGCAATGTTTACCGAATGCTTCTCGAGAAGCATTCGGTAAACATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006083.2-752s1c1
Sequence:CCGGGCAATGTTTACCGAATGCTTTCTCGAGAAAGCATTCGGTAAACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-950s21c1
Sequence:CCGGCAAGCTGACCCAGATCCTTTCCTCGAGGAAAGGATCTGGGTCAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1044s21c1
Sequence:CCGGCCTGAGGCTGACATGAATATTCTCGAGAATATTCATGTCAGCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1703s21c1
Sequence:CCGGGTGGAAGAAGATTAGTGCAATCTCGAGATTGCACTAATCTTCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-469s21c1
Sequence:CCGGTCAGCACCACAGCTAACTATACTCGAGTATAGTTAGCTGTGGTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006083.3-1314s21c1
Sequence:CCGGTCTACCAAGGAGTTGATCAAGCTCGAGCTTGATCAACTCCTTGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)