EMAIL THIS PAGE TO A FRIEND

IKBIP

IKBKB interacting protein

133 Gene Product Result for
Synonyms: IKIP
UniProtKB ID: Q70UQ0, Q6ZWH4, Q70UP9, Q86V91, Q96ND2
Gene ID:
Mouse(67454) IKBKB interacting protein
Rat(314730) IKBKB interacting protein
chicken(417925) IKBKB interacting protein
dog(482619) IKBKB interacting protein
cow(540640) IKBKB interacting protein
domestic guinea pig(100724963) IKBKB interacting protein
naked mole-rat(101721927) IKBKB interacting protein
sheep(101123198) IKBKB interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_026166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153687 Rosetta Predictions human pricing
NM_201612 Rosetta Predictions human pricing
NM_201613 Rosetta Predictions human pricing
NM_201614 Rosetta Predictions human pricing
NM_001009430 Rosetta Predictions rat pricing
NM_026166 Rosetta Predictions mouse pricing
NM_027078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070413 predicted 1298
2 SASI_Hs01_00070414 predicted 476
3 SASI_Hs01_00070415 predicted 803
4 SASI_Hs01_00070416 predicted 927
5 SASI_Hs02_00367400 predicted 911
6 SASI_Hs01_00070417 predicted 1078
7 SASI_Hs01_00070418 predicted 1162
8 SASI_Hs01_00070419 predicted 1089
9 SASI_Hs01_00070420 predicted 940
10 SASI_Hs01_00070421 predicted 726
11 SASI_Hs01_00070422 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178107 predicted 991
2 SASI_Hs01_00178108 predicted 1056
3 SASI_Hs01_00178109 predicted 980
4 SASI_Hs01_00178112 predicted 1098
5 SASI_Hs01_00178114 predicted 1103
6 SASI_Hs02_00373124 predicted 1103
7 SASI_Hs01_00178115 predicted 984
8 SASI_Hs01_00178116 predicted 1098
9 SASI_Hs02_00373125 predicted 1028
10 SASI_Hs02_00373126 predicted 982
11 SASI_Hs01_00178110 predicted 999
12 SASI_Hs01_00178111 predicted 1043
13 SASI_Hs01_00178113 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052368 predicted 297
2 SASI_Hs01_00052369 predicted 428
3 SASI_Hs01_00052370 predicted 535
4 SASI_Hs01_00052372 predicted 553
5 SASI_Hs01_00052373 predicted 742
6 SASI_Hs01_00052374 predicted 667
7 SASI_Hs01_00052375 predicted 232
8 SASI_Hs02_00373127 predicted 489
9 SASI_Hs01_00052376 predicted 281
10 SASI_Hs01_00052377 predicted 465
11 SASI_Hs01_00052371 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204618 predicted 877
2 SASI_Hs01_00204619 predicted 940
3 SASI_Hs01_00204620 predicted 863
4 SASI_Hs01_00204621 predicted 877
5 SASI_Hs01_00204622 predicted 927
6 SASI_Hs01_00204623 predicted 993
7 SASI_Hs01_00204624 predicted 873
8 SASI_Hs01_00204625 predicted 992
9 SASI_Hs01_00204626 predicted 875
10 SASI_Hs01_00204627 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199534 predicted 376
2 SASI_Rn02_00199535 predicted 284
3 SASI_Rn02_00199536 predicted 308
4 SASI_Rn02_00199537 predicted 263
5 SASI_Rn02_00199538 predicted 734
6 SASI_Rn02_00199539 predicted 523
7 SASI_Rn02_00199540 predicted 402
8 SASI_Rn02_00199541 predicted 310
9 SASI_Rn02_00199542 predicted 317
10 SASI_Rn02_00199543 predicted 801
11 SASI_Rn01_00072077 predicted 489
12 SASI_Rn01_00072078 predicted 575
13 SASI_Rn01_00072079 predicted 341
14 SASI_Rn01_00072080 predicted 744
15 SASI_Rn01_00072081 predicted 385
16 SASI_Rn01_00072082 predicted 460
17 SASI_Rn01_00072083 predicted 609
18 SASI_Rn01_00072084 predicted 734
19 SASI_Rn01_00072085 predicted 480
20 SASI_Rn01_00072086 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329794 predicted 370
2 SASI_Mm02_00329795 predicted 787
3 SASI_Mm02_00329796 predicted 845
4 SASI_Mm02_00329797 predicted 521
5 SASI_Mm02_00329798 predicted 760
6 SASI_Mm02_00329799 predicted 409
7 SASI_Mm02_00329800 predicted 617
8 SASI_Mm02_00329801 predicted 574
9 SASI_Mm02_00329802 predicted 398
10 SASI_Mm02_00329803 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056827 predicted 253
2 SASI_Mm01_00056829 predicted 468
3 SASI_Mm02_00331505 predicted 409
4 SASI_Mm01_00056830 predicted 368
5 SASI_Mm01_00056831 predicted 761
6 SASI_Mm01_00056832 predicted 504
7 SASI_Mm01_00056834 predicted 740
8 SASI_Mm01_00056835 predicted 827
9 SASI_Mm01_00056836 predicted 620
10 SASI_Mm02_00331506 predicted 579
11 SASI_Mm01_00056828 predicted 539
12 SASI_Mm01_00056833 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153687
VALIDATED
IKBIP MISSION shRNA Bacterial Glycerol Stock
IKBKB interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153687.2-1324s21c1
Sequence:CCGGCCTCATCTTATCCTACATTATCTCGAGATAATGTAGGATAAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153687.2-698s21c1
Sequence:CCGGATTGCTCACTGAACGGCTAAACTCGAGTTTAGCCGTTCAGTGAGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153687.2-1260s21c1
Sequence:CCGGTCTGATGAACCATATCATTATCTCGAGATAATGATATGGTTCATCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-429s1c1
Sequence:CCGGCAGGAAGTATCCAACCTCCAACTCGAGTTGGAGGTTGGATACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-830s1c1
Sequence:CCGGGACTAATAAACTTTCCGACTACTCGAGTAGTCGGAAAGTTTATTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-885s1c1
Sequence:CCGGCCAACAATTGAAAGTGCTATTCTCGAGAATAGCACTTTCAATTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-610s1c1
Sequence:CCGGCTCAAGTAACTGTCCAAATTACTCGAGTAATTTGGACAGTTACTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-550s1c1
Sequence:CCGGGCCTAGAAGAAATGAACATTACTCGAGTAATGTTCATTTCTTCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153687.1-500s1c1
Sequence:CCGGGCAAAGCCTTAATGAGAAATTCTCGAGAATTTCTCATTAAGGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153687
VALIDATED
IKBIP MISSION shRNA shRNA Plasmid DNA
IKBKB interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153687.2-1324s21c1
Sequence:CCGGCCTCATCTTATCCTACATTATCTCGAGATAATGTAGGATAAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153687.2-698s21c1
Sequence:CCGGATTGCTCACTGAACGGCTAAACTCGAGTTTAGCCGTTCAGTGAGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153687.2-1260s21c1
Sequence:CCGGTCTGATGAACCATATCATTATCTCGAGATAATGATATGGTTCATCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-429s1c1
Sequence:CCGGCAGGAAGTATCCAACCTCCAACTCGAGTTGGAGGTTGGATACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-830s1c1
Sequence:CCGGGACTAATAAACTTTCCGACTACTCGAGTAGTCGGAAAGTTTATTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-885s1c1
Sequence:CCGGCCAACAATTGAAAGTGCTATTCTCGAGAATAGCACTTTCAATTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-610s1c1
Sequence:CCGGCTCAAGTAACTGTCCAAATTACTCGAGTAATTTGGACAGTTACTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-550s1c1
Sequence:CCGGGCCTAGAAGAAATGAACATTACTCGAGTAATGTTCATTTCTTCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153687.1-500s1c1
Sequence:CCGGGCAAAGCCTTAATGAGAAATTCTCGAGAATTTCTCATTAAGGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153687
VALIDATED
IKBIP MISSION shRNA Lentiviral Transduction Particles
IKBKB interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153687.2-1324s21c1
Sequence:CCGGCCTCATCTTATCCTACATTATCTCGAGATAATGTAGGATAAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153687.2-698s21c1
Sequence:CCGGATTGCTCACTGAACGGCTAAACTCGAGTTTAGCCGTTCAGTGAGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153687.2-1260s21c1
Sequence:CCGGTCTGATGAACCATATCATTATCTCGAGATAATGATATGGTTCATCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-429s1c1
Sequence:CCGGCAGGAAGTATCCAACCTCCAACTCGAGTTGGAGGTTGGATACTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-830s1c1
Sequence:CCGGGACTAATAAACTTTCCGACTACTCGAGTAGTCGGAAAGTTTATTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-885s1c1
Sequence:CCGGCCAACAATTGAAAGTGCTATTCTCGAGAATAGCACTTTCAATTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-610s1c1
Sequence:CCGGCTCAAGTAACTGTCCAAATTACTCGAGTAATTTGGACAGTTACTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153687.1-550s1c1
Sequence:CCGGGCCTAGAAGAAATGAACATTACTCGAGTAATGTTCATTTCTTCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153687.1-500s1c1
Sequence:CCGGGCAAAGCCTTAATGAGAAATTCTCGAGAATTTCTCATTAAGGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027078
VALIDATED
IKBIP MISSION shRNA Bacterial Glycerol Stock
IKBKB interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-524s21c1
Sequence:CCGGAGACTTTCTGAGGACATTATACTCGAGTATAATGTCCTCAGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-418s21c1
Sequence:CCGGCCAAATAGCGGCTCATCTAAACTCGAGTTTAGATGAGCCGCTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-577s21c1
Sequence:CCGGAGACATGGGCCTCAAGATTACCTCGAGGTAATCTTGAGGCCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-998s21c1
Sequence:CCGGAGACTAGGTTCTGACTTAATGCTCGAGCATTAAGTCAGAACCTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-1069s21c1
Sequence:CCGGAGTAGTCCAAGCTGCGATTAACTCGAGTTAATCGCAGCTTGGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027078.1-285s1c1
Sequence:CCGGCAAACAGAGAGCAGCGAGTTTCTCGAGAAACTCGCTGCTCTCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027078.1-469s1c1
Sequence:CCGGGCACACTGAATAACACACTAACTCGAGTTAGTGTGTTATTCAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027078.1-890s1c1
Sequence:CCGGGCCAAAGGTCTCTAATCTGAACTCGAGTTCAGATTAGAGACCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027078
VALIDATED
IKBIP MISSION shRNA shRNA Plasmid DNA
IKBKB interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-524s21c1
Sequence:CCGGAGACTTTCTGAGGACATTATACTCGAGTATAATGTCCTCAGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-418s21c1
Sequence:CCGGCCAAATAGCGGCTCATCTAAACTCGAGTTTAGATGAGCCGCTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-577s21c1
Sequence:CCGGAGACATGGGCCTCAAGATTACCTCGAGGTAATCTTGAGGCCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-998s21c1
Sequence:CCGGAGACTAGGTTCTGACTTAATGCTCGAGCATTAAGTCAGAACCTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-1069s21c1
Sequence:CCGGAGTAGTCCAAGCTGCGATTAACTCGAGTTAATCGCAGCTTGGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027078.1-285s1c1
Sequence:CCGGCAAACAGAGAGCAGCGAGTTTCTCGAGAAACTCGCTGCTCTCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027078.1-469s1c1
Sequence:CCGGGCACACTGAATAACACACTAACTCGAGTTAGTGTGTTATTCAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027078.1-890s1c1
Sequence:CCGGGCCAAAGGTCTCTAATCTGAACTCGAGTTCAGATTAGAGACCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027078
VALIDATED
IKBIP MISSION shRNA Lentiviral Transduction Particles
IKBKB interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-524s21c1
Sequence:CCGGAGACTTTCTGAGGACATTATACTCGAGTATAATGTCCTCAGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-418s21c1
Sequence:CCGGCCAAATAGCGGCTCATCTAAACTCGAGTTTAGATGAGCCGCTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-577s21c1
Sequence:CCGGAGACATGGGCCTCAAGATTACCTCGAGGTAATCTTGAGGCCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-998s21c1
Sequence:CCGGAGACTAGGTTCTGACTTAATGCTCGAGCATTAAGTCAGAACCTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027078.2-1069s21c1
Sequence:CCGGAGTAGTCCAAGCTGCGATTAACTCGAGTTAATCGCAGCTTGGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027078.1-285s1c1
Sequence:CCGGCAAACAGAGAGCAGCGAGTTTCTCGAGAAACTCGCTGCTCTCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027078.1-469s1c1
Sequence:CCGGGCACACTGAATAACACACTAACTCGAGTTAGTGTGTTATTCAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027078.1-890s1c1
Sequence:CCGGGCCAAAGGTCTCTAATCTGAACTCGAGTTCAGATTAGAGACCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026166
VALIDATED
IKBIP MISSION shRNA Bacterial Glycerol Stock
IKBKB interacting protein
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000191307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026166.1-419s1c1
Sequence:CCGGCAAAGATCCATACGTGATATTCTCGAGAATATCACGTATGGATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026166.1-478s1c1
Sequence:CCGGCCTTAATGAGAAATTCCAGAACTCGAGTTCTGGAATTTCTCATTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026166
VALIDATED
IKBIP MISSION shRNA shRNA Plasmid DNA
IKBKB interacting protein
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000191307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026166.1-419s1c1
Sequence:CCGGCAAAGATCCATACGTGATATTCTCGAGAATATCACGTATGGATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026166.1-478s1c1
Sequence:CCGGCCTTAATGAGAAATTCCAGAACTCGAGTTCTGGAATTTCTCATTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026166
VALIDATED
IKBIP MISSION shRNA Lentiviral Transduction Particles
IKBKB interacting protein
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000191307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026166.1-419s1c1
Sequence:CCGGCAAAGATCCATACGTGATATTCTCGAGAATATCACGTATGGATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026166.1-478s1c1
Sequence:CCGGCCTTAATGAGAAATTCCAGAACTCGAGTTCTGGAATTTCTCATTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)