EMAIL THIS PAGE TO A FRIEND

IKBKAP

inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein

87 Gene Product Result for
Synonyms: DYS ELP1 FD IKAP IKI3 TOT1
UniProtKB ID: O95163, Q5JSV2, Q9H327, Q9UG87
Gene ID:
Human(8518) Summary: The protein encoded by this gene is a scaffold protein and a regulator for 3 different kinases involved in proinflammatory signaling. This encoded protein can bind NF-kappa-B-inducing kinase (NIK) and IKKs through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. [provided by RefSeq, Jul 2008]
Mouse(230233) inhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein
Rat(140934) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
sheep(101115680) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Domestic Rabbit(100009360) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
domestic guinea pig(100728587) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
naked mole-rat(101723104) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Zebrafish(561039) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
chicken(427375) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
dog(612455) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
domestic cat(101089153) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
cow(505465) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Horse(100053999) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003640 Rosetta Predictions human pricing
NM_080899 Rosetta Predictions rat pricing
NM_026079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104768 predicted 2899
2 SASI_Hs02_00335997 predicted 4367
3 SASI_Hs01_00104769 predicted 1508
4 SASI_Hs01_00104771 predicted 2912
5 SASI_Hs01_00104772 predicted 558
6 SASI_Hs01_00104773 predicted 2417
7 SASI_Hs02_00335998 predicted 1684
8 SASI_Hs01_00104774 predicted 2344
9 SASI_Hs02_00335999 predicted 1613
10 SASI_Hs01_00104775 predicted 625
11 SASI_Hs01_00104770 predicted 3122
12 SASI_Hs01_00104776 predicted 4344
13 SASI_Hs01_00104777 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067440 predicted 2218
2 SASI_Rn01_00067441 predicted 2064
3 SASI_Rn01_00067442 predicted 1403
4 SASI_Rn01_00067443 predicted 230
5 SASI_Rn02_00267353 predicted 290
6 SASI_Rn01_00067444 predicted 2882
7 SASI_Rn01_00067445 predicted 3369
8 SASI_Rn01_00067446 predicted 1274
9 SASI_Rn01_00067447 predicted 924
10 SASI_Rn01_00067448 predicted 464
11 SASI_Rn01_00067449 predicted 2932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168720 predicted 2666
2 SASI_Mm01_00168712 predicted 3792
3 SASI_Mm02_00329650 predicted 387
4 SASI_Mm01_00168713 predicted 2994
5 SASI_Mm01_00168714 predicted 2780
6 SASI_Mm01_00168716 predicted 1348
7 SASI_Mm01_00168717 predicted 3480
8 SASI_Mm01_00168718 predicted 1116
9 SASI_Mm01_00168719 predicted 3035
10 SASI_Mm02_00329651 predicted 563
11 SASI_Mm01_00168715 predicted 268
12 SASI_Mm01_00168721 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026079
VALIDATED
IKBKAP MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-2101s21c1
Sequence:CCGGGCATCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026079.1-2028s1c1
Sequence:CCGGCGCATCAAATATCACGTCATTCTCGAGAATGACGTGATATTTGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026079.1-4541s1c1
Sequence:CCGGCCTCAGTTCCTGTTGTTCATACTCGAGTATGAACAACAGGAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026079.1-2029s1c1
Sequence:CCGGGCATCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026079.1-242s1c1
Sequence:CCGGCGGAAGTAGATCCTGTGAGAACTCGAGTTCTCACAGGATCTACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026079.1-3779s1c1
Sequence:CCGGCGCTGAGTGAAGTGGTACAAACTCGAGTTTGTACCACTTCACTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-3482s21c1
Sequence:CCGGAGTATGACAGAGTGGATATTACTCGAGTAATATCCACTCTGTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-3851s21c1
Sequence:CCGGCGCTGAGTGAAGTGGTACAAACTCGAGTTTGTACCACTTCACTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-4613s21c1
Sequence:CCGGCCTCAGTTCCTGTTGTTCATACTCGAGTATGAACAACAGGAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026079.3-3754s21c1
Sequence:CCGGATATCTGCGAGGTCATCTAAACTCGAGTTTAGATGACCTCGCAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026079
VALIDATED
IKBKAP MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-2101s21c1
Sequence:CCGGGCATCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026079.1-2028s1c1
Sequence:CCGGCGCATCAAATATCACGTCATTCTCGAGAATGACGTGATATTTGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026079.1-4541s1c1
Sequence:CCGGCCTCAGTTCCTGTTGTTCATACTCGAGTATGAACAACAGGAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026079.1-2029s1c1
Sequence:CCGGGCATCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026079.1-242s1c1
Sequence:CCGGCGGAAGTAGATCCTGTGAGAACTCGAGTTCTCACAGGATCTACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026079.1-3779s1c1
Sequence:CCGGCGCTGAGTGAAGTGGTACAAACTCGAGTTTGTACCACTTCACTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-3482s21c1
Sequence:CCGGAGTATGACAGAGTGGATATTACTCGAGTAATATCCACTCTGTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-3851s21c1
Sequence:CCGGCGCTGAGTGAAGTGGTACAAACTCGAGTTTGTACCACTTCACTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-4613s21c1
Sequence:CCGGCCTCAGTTCCTGTTGTTCATACTCGAGTATGAACAACAGGAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026079.3-3754s21c1
Sequence:CCGGATATCTGCGAGGTCATCTAAACTCGAGTTTAGATGACCTCGCAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026079
VALIDATED
IKBKAP MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-2101s21c1
Sequence:CCGGGCATCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026079.1-2028s1c1
Sequence:CCGGCGCATCAAATATCACGTCATTCTCGAGAATGACGTGATATTTGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026079.1-4541s1c1
Sequence:CCGGCCTCAGTTCCTGTTGTTCATACTCGAGTATGAACAACAGGAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026079.1-2029s1c1
Sequence:CCGGGCATCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026079.1-242s1c1
Sequence:CCGGCGGAAGTAGATCCTGTGAGAACTCGAGTTCTCACAGGATCTACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026079.1-3779s1c1
Sequence:CCGGCGCTGAGTGAAGTGGTACAAACTCGAGTTTGTACCACTTCACTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-3482s21c1
Sequence:CCGGAGTATGACAGAGTGGATATTACTCGAGTAATATCCACTCTGTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-3851s21c1
Sequence:CCGGCGCTGAGTGAAGTGGTACAAACTCGAGTTTGTACCACTTCACTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026079.3-4613s21c1
Sequence:CCGGCCTCAGTTCCTGTTGTTCATACTCGAGTATGAACAACAGGAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026079.3-3754s21c1
Sequence:CCGGATATCTGCGAGGTCATCTAAACTCGAGTTTAGATGACCTCGCAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003640
VALIDATED
IKBKAP MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_003640.2-2220s1c1
Sequence:CCGGGCGTCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003640.2-3048s1c1
Sequence:CCGGCCCAAAGAATATCTTCCATTTCTCGAGAAATGGAAGATATTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-4162s1c1
Sequence:CCGGCGGTTCTAGGTCCCAATTCTACTCGAGTAGAATTGGGACCTAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-2035s1c1
Sequence:CCGGGCCAGATATTTAAGTACCTTTCTCGAGAAAGGTACTTAAATATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-3543s1c1
Sequence:CCGGGCTGTGCTCTTGCTGTTAGAACTCGAGTTCTAACAGCAAGAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003640.3-2272s21c1
Sequence:CCGGGTCACCTTCTCTGGCTATTAACTCGAGTTAATAGCCAGAGAAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003640.3-2421s21c1
Sequence:GTACCGGACATTGAGGTTGCGTCAAATACTCGAGTATTTGACGCAACCTCAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003640.3-5007s21c1
Sequence:GTACCGGTCCTTTGCTGACAGCTATTATCTCGAGATAATAGCTGTCAGCAAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003640.3-2945s21c1
Sequence:CCGGAGGGATCCTGACGGGAATAAACTCGAGTTTATTCCCGTCAGGATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003640.3-3916s21c1
Sequence:CCGGTCGCCACAAGAAACGTTTATTCTCGAGAATAAACGTTTCTTGTGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003640
VALIDATED
IKBKAP MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_003640.2-2220s1c1
Sequence:CCGGGCGTCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003640.2-3048s1c1
Sequence:CCGGCCCAAAGAATATCTTCCATTTCTCGAGAAATGGAAGATATTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-4162s1c1
Sequence:CCGGCGGTTCTAGGTCCCAATTCTACTCGAGTAGAATTGGGACCTAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-2035s1c1
Sequence:CCGGGCCAGATATTTAAGTACCTTTCTCGAGAAAGGTACTTAAATATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-3543s1c1
Sequence:CCGGGCTGTGCTCTTGCTGTTAGAACTCGAGTTCTAACAGCAAGAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003640.3-2272s21c1
Sequence:CCGGGTCACCTTCTCTGGCTATTAACTCGAGTTAATAGCCAGAGAAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003640.3-2421s21c1
Sequence:GTACCGGACATTGAGGTTGCGTCAAATACTCGAGTATTTGACGCAACCTCAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003640.3-5007s21c1
Sequence:GTACCGGTCCTTTGCTGACAGCTATTATCTCGAGATAATAGCTGTCAGCAAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003640.3-2945s21c1
Sequence:CCGGAGGGATCCTGACGGGAATAAACTCGAGTTTATTCCCGTCAGGATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003640.3-3916s21c1
Sequence:CCGGTCGCCACAAGAAACGTTTATTCTCGAGAATAAACGTTTCTTGTGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003640
VALIDATED
IKBKAP MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_003640.2-2220s1c1
Sequence:CCGGGCGTCAAATATCACGTCATTTCTCGAGAAATGACGTGATATTTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003640.2-3048s1c1
Sequence:CCGGCCCAAAGAATATCTTCCATTTCTCGAGAAATGGAAGATATTCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-4162s1c1
Sequence:CCGGCGGTTCTAGGTCCCAATTCTACTCGAGTAGAATTGGGACCTAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-2035s1c1
Sequence:CCGGGCCAGATATTTAAGTACCTTTCTCGAGAAAGGTACTTAAATATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003640.2-3543s1c1
Sequence:CCGGGCTGTGCTCTTGCTGTTAGAACTCGAGTTCTAACAGCAAGAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003640.3-2272s21c1
Sequence:CCGGGTCACCTTCTCTGGCTATTAACTCGAGTTAATAGCCAGAGAAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003640.3-2421s21c1
Sequence:GTACCGGACATTGAGGTTGCGTCAAATACTCGAGTATTTGACGCAACCTCAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003640.3-5007s21c1
Sequence:GTACCGGTCCTTTGCTGACAGCTATTATCTCGAGATAATAGCTGTCAGCAAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003640.3-2945s21c1
Sequence:CCGGAGGGATCCTGACGGGAATAAACTCGAGTTTATTCCCGTCAGGATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003640.3-3916s21c1
Sequence:CCGGTCGCCACAAGAAACGTTTATTCTCGAGAATAAACGTTTCTTGTGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)