EMAIL THIS PAGE TO A FRIEND

IKBKB

inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta

115 Gene Product Result for
Synonyms: IKK-beta IKK2 IKKB NFKBIKB
UniProtKB ID: O14920, B4DZ30, B4E0U4, O75327
Gene ID:
Human(3551) Summary: The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(16150) inhibitor of kappaB kinase beta
Rat(84351) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Zebrafish(563560) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
chicken(426792) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
cow(281854) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
domestic cat(100142682) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
dog(482839) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
domestic guinea pig(100724538) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
naked mole-rat(101711077) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300550 Anti-IKBKB (Ab-199) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence pricing
GW21171 Anti-IKBKB antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
SAB1406016 Anti-IKBKB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412232 ANTI-IKBKB antibody produced in mouse clone 3C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412406 ANTI-IKBKB antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2108269 Anti-IKBKB antibody produced in rabbit affinity isolated antibody bovine, rat, pig, guinea pig, mouse, human, rabbit, canine, horse
western blot pricing
HPA001249 Anti-IKBKB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103152 Anti-IKBKB, (N-terminal) antibody produced in rabbit affinity isolated antibody pig, human, bovine, guinea pig, canine, horse, mouse, rabbit, rat
western blot pricing
SAB3501108 Anti-IKK beta antibody produced in rabbit affinity isolated antibody human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB1306590 ANTI-IKK BETA antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501535 Anti-IKK-β antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501536 Anti-IKK-β antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB1306717 ANTI-IKKB (CENTER Y609) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1300467 Anti-IKKβ antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1302570 ANTI-MOUSE IKBKB (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4503882 Anti-phospho-IKK-α (pSer176) /IKK-β (pSer177) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4503881 Anti-phospho-IKK-α/β (pSer180/181) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4503883 Anti-phospho-IKK-β (pTyr188) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301428 Anti-phospho-IKK-β (pTyr188) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4503922 Anti-phospho-IKK-β (pTyr199) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB1305615 ANTI-PHOSPHO-IKKB(S177) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305604 ANTI-PHOSPHO-IKKB(S466) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305605 ANTI-PHOSPHO-IKKB(S670) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305609 ANTI-PHOSPHO-IKKB(S672) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305581 ANTI-PHOSPHO-IKKB(S675) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305610 ANTI-PHOSPHO-IKKB(S682) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305606 ANTI-PHOSPHO-IKKB(S689) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305608 ANTI-PHOSPHO-IKKB(S692) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305607 ANTI-PHOSPHO-IKKB(S697) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305611 ANTI-PHOSPHO-IKKB(S705) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305612 ANTI-PHOSPHO-IKKB(S733) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305616 ANTI-PHOSPHO-IKKB(T180) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305994 ANTI-PHOSPHO-IKKB(Y199) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1305622 ANTI-PHOSPHO-IKKB(Y609) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305617 ANTI-PHOSPHO-MOUSE IKKB(S701) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
pricing
SAB1403966 Monoclonal Anti-IKBKB antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB5300447 Monoclonal Anti-IKBKB antibody produced in mouse clone 10A2, ascites fluid human
ELISA, western blot pricing
SAB5300448 Monoclonal Anti-IKBKB antibody produced in mouse clone 10A2C5B3, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB1402240 Monoclonal Anti-IKBKB antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1305530 MONOCLONAL ANTI-IKK BETA antibody produced in mouse clone 62AT992, IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1305529 MONOCLONAL ANTI-IKK BETA antibody produced in mouse clone 62AT216, IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
PLA0218 Rabbit anti-IKK-beta Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, gorilla, rhesus monkey, marmoset, primate, chimpanzee
immunoprecipitation (IP), proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N6252 Norharmane crystalline human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001556 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001556 Rosetta Predictions human pricing
NM_053355 Rosetta Predictions rat pricing
NM_010546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156170 predicted 571
2 SASI_Hs01_00156172 predicted 896
3 SASI_Hs01_00156174 predicted 1958
4 SASI_Hs01_00156175 predicted 550
5 SASI_Hs01_00156176 predicted 1797
6 SASI_Hs01_00156178 predicted 1314
7 SASI_Hs02_00332122 predicted 2308
8 SASI_Hs02_00332123 predicted 1991
9 SASI_Hs01_00156179 predicted 2193
10 SASI_Hs02_00332124 predicted 918
11 SASI_Hs01_00156171 predicted 648
12 SASI_Hs01_00156173 predicted 1396
13 SASI_Hs01_00156177 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073906 predicted 1551
2 SASI_Rn01_00073907 predicted 2076
3 SASI_Rn01_00073908 predicted 489
4 SASI_Rn01_00073909 predicted 1098
5 SASI_Rn01_00073910 predicted 550
6 SASI_Rn01_00073911 predicted 801
7 SASI_Rn02_00265823 predicted 1908
8 SASI_Rn01_00073912 predicted 421
9 SASI_Rn01_00073913 predicted 1926
10 SASI_Rn01_00073914 predicted 1708
11 SASI_Rn01_00073915 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132409 predicted 1925
2 SASI_Mm01_00132411 predicted 2094
3 SASI_Mm01_00132412 predicted 513
4 SASI_Mm01_00132413 predicted 2141
5 SASI_Mm01_00132414 predicted 1938
6 SASI_Mm01_00132415 predicted 2314
7 SASI_Mm01_00132416 predicted 851
8 SASI_Mm01_00132417 predicted 862
9 SASI_Mm01_00132418 predicted 433
10 SASI_Mm02_00318801 predicted 1248
11 SASI_Mm01_00132410 predicted 1965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001556
VALIDATED
IKBKB MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-2202s21c1
Sequence:GTACCGGCATGAATGCCTCTCGACTTAGCTCGAGCTAAGTCGAGAGGCATTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-640s21c1
Sequence:CCGGCAAGGAGAACAGAGGTTAATACTCGAGTATTAACCTCTGTTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-2278s21c1
Sequence:CCGGCCAGCCAAGAAGAGTGAAGAACTCGAGTTCTTCACTCTTCTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-1107s21c1
Sequence:CCGGGCTGGTTCATATCTTGAACATCTCGAGATGTTCAAGATATGAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-490s21c1
Sequence:CCGGCGGAAGTACCTGAACCAGTTTCTCGAGAAACTGGTTCAGGTACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-1286s21c1
Sequence:GTACCGGGTATTTCAGACGGCAAGTTAACTCGAGTTAACTTGCCGTCTGAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-1667s21c1
Sequence:GTACCGGACAGCGAGCAAACCGAGTTTGCTCGAGCAAACTCGGTTTGCTCGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-703s21c1
Sequence:GTACCGGGGCAGTCTTTGCACATCATTCCTCGAGGAATGATGTGCAAAGACTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-598s21c1
Sequence:GTACCGGATCATCCATCGGGATCTAAAGCTCGAGCTTTAGATCCCGATGGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-1538s1c1
Sequence:CCGGCCATGATGAATCTCCTCCGAACTCGAGTTCGGAGGAGATTCATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-490s1c1
Sequence:CCGGCGGAAGTACCTGAACCAGTTTCTCGAGAAACTGGTTCAGGTACTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-1107s1c1
Sequence:CCGGGCTGGTTCATATCTTGAACATCTCGAGATGTTCAAGATATGAACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-2278s1c1
Sequence:CCGGCCAGCCAAGAAGAGTGAAGAACTCGAGTTCTTCACTCTTCTTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-3745s1c1
Sequence:CCGGGCACTGGGAAAGTATCTGAAACTCGAGTTTCAGATACTTTCCCAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001556.1-3073s1c1
Sequence:CCGGCCTACTACTTTGGTGGTTGTCCTCGAGGACAACCACCAAAGTAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001556
VALIDATED
IKBKB MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-2202s21c1
Sequence:GTACCGGCATGAATGCCTCTCGACTTAGCTCGAGCTAAGTCGAGAGGCATTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-640s21c1
Sequence:CCGGCAAGGAGAACAGAGGTTAATACTCGAGTATTAACCTCTGTTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-2278s21c1
Sequence:CCGGCCAGCCAAGAAGAGTGAAGAACTCGAGTTCTTCACTCTTCTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-1107s21c1
Sequence:CCGGGCTGGTTCATATCTTGAACATCTCGAGATGTTCAAGATATGAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-490s21c1
Sequence:CCGGCGGAAGTACCTGAACCAGTTTCTCGAGAAACTGGTTCAGGTACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-1286s21c1
Sequence:GTACCGGGTATTTCAGACGGCAAGTTAACTCGAGTTAACTTGCCGTCTGAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-1667s21c1
Sequence:GTACCGGACAGCGAGCAAACCGAGTTTGCTCGAGCAAACTCGGTTTGCTCGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-703s21c1
Sequence:GTACCGGGGCAGTCTTTGCACATCATTCCTCGAGGAATGATGTGCAAAGACTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-598s21c1
Sequence:GTACCGGATCATCCATCGGGATCTAAAGCTCGAGCTTTAGATCCCGATGGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-1538s1c1
Sequence:CCGGCCATGATGAATCTCCTCCGAACTCGAGTTCGGAGGAGATTCATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-490s1c1
Sequence:CCGGCGGAAGTACCTGAACCAGTTTCTCGAGAAACTGGTTCAGGTACTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-1107s1c1
Sequence:CCGGGCTGGTTCATATCTTGAACATCTCGAGATGTTCAAGATATGAACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-2278s1c1
Sequence:CCGGCCAGCCAAGAAGAGTGAAGAACTCGAGTTCTTCACTCTTCTTGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-3745s1c1
Sequence:CCGGGCACTGGGAAAGTATCTGAAACTCGAGTTTCAGATACTTTCCCAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001556.1-3073s1c1
Sequence:CCGGCCTACTACTTTGGTGGTTGTCCTCGAGGACAACCACCAAAGTAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001556
VALIDATED
IKBKB MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-2202s21c1
Sequence:GTACCGGCATGAATGCCTCTCGACTTAGCTCGAGCTAAGTCGAGAGGCATTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-640s21c1
Sequence:CCGGCAAGGAGAACAGAGGTTAATACTCGAGTATTAACCTCTGTTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-2278s21c1
Sequence:CCGGCCAGCCAAGAAGAGTGAAGAACTCGAGTTCTTCACTCTTCTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001556.1-1107s21c1
Sequence:CCGGGCTGGTTCATATCTTGAACATCTCGAGATGTTCAAGATATGAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-490s21c1
Sequence:CCGGCGGAAGTACCTGAACCAGTTTCTCGAGAAACTGGTTCAGGTACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-1286s21c1
Sequence:GTACCGGGTATTTCAGACGGCAAGTTAACTCGAGTTAACTTGCCGTCTGAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-1667s21c1
Sequence:GTACCGGACAGCGAGCAAACCGAGTTTGCTCGAGCAAACTCGGTTTGCTCGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-703s21c1
Sequence:GTACCGGGGCAGTCTTTGCACATCATTCCTCGAGGAATGATGTGCAAAGACTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001556.1-598s21c1
Sequence:GTACCGGATCATCCATCGGGATCTAAAGCTCGAGCTTTAGATCCCGATGGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-1538s1c1
Sequence:CCGGCCATGATGAATCTCCTCCGAACTCGAGTTCGGAGGAGATTCATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-490s1c1
Sequence:CCGGCGGAAGTACCTGAACCAGTTTCTCGAGAAACTGGTTCAGGTACTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-1107s1c1
Sequence:CCGGGCTGGTTCATATCTTGAACATCTCGAGATGTTCAAGATATGAACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-2278s1c1
Sequence:CCGGCCAGCCAAGAAGAGTGAAGAACTCGAGTTCTTCACTCTTCTTGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001556.1-3745s1c1
Sequence:CCGGGCACTGGGAAAGTATCTGAAACTCGAGTTTCAGATACTTTCCCAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001556.1-3073s1c1
Sequence:CCGGCCTACTACTTTGGTGGTTGTCCTCGAGGACAACCACCAAAGTAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010546
VALIDATED
IKBKB MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-658s21c1
Sequence:CCGGGGCAGTCTGTGCACGTCATTTCTCGAGAAATGACGTGCACAGACTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-849s21c1
Sequence:CCGGCGAAGTGGACATCGTTGTTAGCTCGAGCTAACAACGATGTCCACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010546.2-2789s21c1
Sequence:CCGGCTAACTACTCTTGCATCTAACCTCGAGGTTAGATGCAAGAGTAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-1725s21c1
Sequence:CCGGGCATCTAGTAGAGCGGATGATCTCGAGATCATCCGCTCTACTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-1497s21c1
Sequence:CCGGGATGAGTCTCCTCCGGAATAACTCGAGTTATTCCGGAGGAGACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010546.1-520s1c1
Sequence:CCGGGCTCTTAGATACCTTCACGAACTCGAGTTCGTGAAGGTATCTAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010546.1-2217s1c1
Sequence:CCGGCTTACCTGAATCAGACAAGAACTCGAGTTCTTGTCTGATTCAGGTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010546.1-1719s1c1
Sequence:CCGGGCATCTAGTAGAGCGGATGATCTCGAGATCATCCGCTCTACTAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010546.1-3112s1c1
Sequence:CCGGGCTGCACATTTGAATCTGTAACTCGAGTTACAGATTCAAATGTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010546
VALIDATED
IKBKB MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-658s21c1
Sequence:CCGGGGCAGTCTGTGCACGTCATTTCTCGAGAAATGACGTGCACAGACTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-849s21c1
Sequence:CCGGCGAAGTGGACATCGTTGTTAGCTCGAGCTAACAACGATGTCCACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010546.2-2789s21c1
Sequence:CCGGCTAACTACTCTTGCATCTAACCTCGAGGTTAGATGCAAGAGTAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-1725s21c1
Sequence:CCGGGCATCTAGTAGAGCGGATGATCTCGAGATCATCCGCTCTACTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-1497s21c1
Sequence:CCGGGATGAGTCTCCTCCGGAATAACTCGAGTTATTCCGGAGGAGACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010546.1-520s1c1
Sequence:CCGGGCTCTTAGATACCTTCACGAACTCGAGTTCGTGAAGGTATCTAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010546.1-2217s1c1
Sequence:CCGGCTTACCTGAATCAGACAAGAACTCGAGTTCTTGTCTGATTCAGGTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010546.1-1719s1c1
Sequence:CCGGGCATCTAGTAGAGCGGATGATCTCGAGATCATCCGCTCTACTAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010546.1-3112s1c1
Sequence:CCGGGCTGCACATTTGAATCTGTAACTCGAGTTACAGATTCAAATGTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010546
VALIDATED
IKBKB MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-658s21c1
Sequence:CCGGGGCAGTCTGTGCACGTCATTTCTCGAGAAATGACGTGCACAGACTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-849s21c1
Sequence:CCGGCGAAGTGGACATCGTTGTTAGCTCGAGCTAACAACGATGTCCACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010546.2-2789s21c1
Sequence:CCGGCTAACTACTCTTGCATCTAACCTCGAGGTTAGATGCAAGAGTAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-1725s21c1
Sequence:CCGGGCATCTAGTAGAGCGGATGATCTCGAGATCATCCGCTCTACTAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010546.2-1497s21c1
Sequence:CCGGGATGAGTCTCCTCCGGAATAACTCGAGTTATTCCGGAGGAGACTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010546.1-520s1c1
Sequence:CCGGGCTCTTAGATACCTTCACGAACTCGAGTTCGTGAAGGTATCTAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010546.1-2217s1c1
Sequence:CCGGCTTACCTGAATCAGACAAGAACTCGAGTTCTTGTCTGATTCAGGTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010546.1-1719s1c1
Sequence:CCGGGCATCTAGTAGAGCGGATGATCTCGAGATCATCCGCTCTACTAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010546.1-3112s1c1
Sequence:CCGGGCTGCACATTTGAATCTGTAACTCGAGTTACAGATTCAAATGTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)