EMAIL THIS PAGE TO A FRIEND

IKBKE

inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon

69 Gene Product Result for
Synonyms: IKK-E IKK-i IKKE IKKI
UniProtKB ID: Q14164, D3DT78, Q3B754, Q3KR43, Q5JTS6
Gene ID:
Human(9641) Summary: IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]
Mouse(56489) inhibitor of kappaB kinase epsilon
Rat(363984) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
sheep(101116923) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
domestic guinea pig(100716187) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
naked mole-rat(101697947) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Zebrafish(437024) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
cow(533216) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Horse(100055384) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
domestic cat(101086282) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
dog(478950) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
chicken(430480) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014002 Rosetta Predictions human pricing
NM_001108854 Rosetta Predictions rat pricing
NM_019777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107520 predicted 816
2 SASI_Hs01_00107521 predicted 1285
3 SASI_Hs01_00107522 predicted 1052
4 SASI_Hs02_00344971 predicted 2077
5 SASI_Hs01_00107523 predicted 2476
6 SASI_Hs01_00107524 predicted 2390
7 SASI_Hs01_00107525 predicted 376
8 SASI_Hs01_00107527 predicted 731
9 SASI_Hs01_00107528 predicted 430
10 SASI_Hs02_00344972 predicted 1057
11 SASI_Hs01_00107526 predicted 2090
12 SASI_Hs01_00107529 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242735 predicted 826
2 SASI_Rn02_00242736 predicted 1608
3 SASI_Rn02_00242737 predicted 2552
4 SASI_Rn02_00242738 predicted 400
5 SASI_Rn02_00242739 predicted 1681
6 SASI_Rn02_00242740 predicted 2176
7 SASI_Rn02_00242741 predicted 1297
8 SASI_Rn02_00242742 predicted 2481
9 SASI_Rn02_00242743 predicted 1065
10 SASI_Rn02_00242744 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050083 predicted 646
2 SASI_Mm01_00050084 predicted 2071
3 SASI_Mm02_00324977 predicted 1944
4 SASI_Mm01_00050085 predicted 2454
5 SASI_Mm01_00050086 predicted 2275
6 SASI_Mm01_00050087 predicted 373
7 SASI_Mm01_00050088 predicted 473
8 SASI_Mm01_00050089 predicted 1036
9 SASI_Mm01_00050090 predicted 2404
10 SASI_Mm01_00050091 predicted 2525
11 SASI_Mm01_00050092 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014002
VALIDATED
IKBKE MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014002.2-757s1c1
Sequence:CCGGGCATTGTGCATCGCGACATCACTCGAGTGATGTCGCGATGCACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014002.2-2543s1c1
Sequence:CCGGCCTGAAGCATTAGAATGATTCCTCGAGGAATCATTCTAATGCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1307s1c1
Sequence:CCGGTGCCCACAACACGATAGCCATCTCGAGATGGCTATCGTGTTGTGGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1628s1c1
Sequence:CCGGTGGGCAGGAGCTAATGTTTCGCTCGAGCGAAACATTAGCTCCTGCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1208s1c1
Sequence:CCGGCTTCGACCAGTTCTTTGCGGACTCGAGTCCGCAAAGAACTGGTCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-2132s1c1
Sequence:CCGGGTCCTTAGTCACACACGGCAACTCGAGTTGCCGTGTGTGACTAAGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014002.2-2854s21c1
Sequence:CCGGTCCCACTCCCTCTGGTTTATACTCGAGTATAAACCAGAGGGAGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-2473s21c1
Sequence:CCGGGCATCATCGAACGGCTAAATACTCGAGTATTTAGCCGTTCGATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-2090s21c1
Sequence:CCGGCAAGCTGGATAAGGTGAATTTCTCGAGAAATTCACCTTATCCAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-1325s21c1
Sequence:CCGGAGTCCTGCACCACATCTATATCTCGAGATATAGATGTGGTGCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014002.2-871s21c1
Sequence:CCGGAGAAGTTCGTCTCGGTCTATGCTCGAGCATAGACCGAGACGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014002
VALIDATED
IKBKE MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014002.2-757s1c1
Sequence:CCGGGCATTGTGCATCGCGACATCACTCGAGTGATGTCGCGATGCACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014002.2-2543s1c1
Sequence:CCGGCCTGAAGCATTAGAATGATTCCTCGAGGAATCATTCTAATGCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1307s1c1
Sequence:CCGGTGCCCACAACACGATAGCCATCTCGAGATGGCTATCGTGTTGTGGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1628s1c1
Sequence:CCGGTGGGCAGGAGCTAATGTTTCGCTCGAGCGAAACATTAGCTCCTGCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1208s1c1
Sequence:CCGGCTTCGACCAGTTCTTTGCGGACTCGAGTCCGCAAAGAACTGGTCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-2132s1c1
Sequence:CCGGGTCCTTAGTCACACACGGCAACTCGAGTTGCCGTGTGTGACTAAGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014002.2-2854s21c1
Sequence:CCGGTCCCACTCCCTCTGGTTTATACTCGAGTATAAACCAGAGGGAGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-2473s21c1
Sequence:CCGGGCATCATCGAACGGCTAAATACTCGAGTATTTAGCCGTTCGATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-2090s21c1
Sequence:CCGGCAAGCTGGATAAGGTGAATTTCTCGAGAAATTCACCTTATCCAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-1325s21c1
Sequence:CCGGAGTCCTGCACCACATCTATATCTCGAGATATAGATGTGGTGCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014002.2-871s21c1
Sequence:CCGGAGAAGTTCGTCTCGGTCTATGCTCGAGCATAGACCGAGACGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014002
VALIDATED
IKBKE MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014002.2-757s1c1
Sequence:CCGGGCATTGTGCATCGCGACATCACTCGAGTGATGTCGCGATGCACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014002.2-2543s1c1
Sequence:CCGGCCTGAAGCATTAGAATGATTCCTCGAGGAATCATTCTAATGCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1307s1c1
Sequence:CCGGTGCCCACAACACGATAGCCATCTCGAGATGGCTATCGTGTTGTGGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1628s1c1
Sequence:CCGGTGGGCAGGAGCTAATGTTTCGCTCGAGCGAAACATTAGCTCCTGCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-1208s1c1
Sequence:CCGGCTTCGACCAGTTCTTTGCGGACTCGAGTCCGCAAAGAACTGGTCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014002.x-2132s1c1
Sequence:CCGGGTCCTTAGTCACACACGGCAACTCGAGTTGCCGTGTGTGACTAAGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014002.2-2854s21c1
Sequence:CCGGTCCCACTCCCTCTGGTTTATACTCGAGTATAAACCAGAGGGAGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-2473s21c1
Sequence:CCGGGCATCATCGAACGGCTAAATACTCGAGTATTTAGCCGTTCGATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-2090s21c1
Sequence:CCGGCAAGCTGGATAAGGTGAATTTCTCGAGAAATTCACCTTATCCAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014002.2-1325s21c1
Sequence:CCGGAGTCCTGCACCACATCTATATCTCGAGATATAGATGTGGTGCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_014002.2-871s21c1
Sequence:CCGGAGAAGTTCGTCTCGGTCTATGCTCGAGCATAGACCGAGACGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019777
VALIDATED
IKBKE MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-838s1c1
Sequence:CCGGCTGGACGATGATGAGAAGTTTCTCGAGAAACTTCTCATCATCGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019777.2-1552s1c1
Sequence:CCGGCCAAAGTTCGTCCCTAAGGTTCTCGAGAACCTTAGGGACGAACTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-2455s1c1
Sequence:CCGGCGACTCATCGAACGGTTACATCTCGAGATGTAACCGTTCGATGAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019777.2-1977s1c1
Sequence:CCGGCCAGAAGATTCAGTGTTGTTTCTCGAGAAACAACACTGAATCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-2400s1c1
Sequence:CCGGGCAGGAGCTTTGTAATGATATCTCGAGATATCATTACAAAGCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2453s21c1
Sequence:CCGGCGACTCATCGAACGGTTACATCTCGAGATGTAACCGTTCGATGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2632s21c1
Sequence:CCGGTTGGCCAACAAACTAGCATTACTCGAGTAATGCTAGTTTGTTGGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2074s21c1
Sequence:CCGGCCACAAGCTGGATAAGGTAAACTCGAGTTTACCTTATCCAGCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019777.3-2398s21c1
Sequence:CCGGGCAGGAGCTTTGTAATGATATCTCGAGATATCATTACAAAGCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-1567s21c1
Sequence:CCGGGGTTGACCTACAGGCCGATTACTCGAGTAATCGGCCTGTAGGTCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019777
VALIDATED
IKBKE MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-838s1c1
Sequence:CCGGCTGGACGATGATGAGAAGTTTCTCGAGAAACTTCTCATCATCGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019777.2-1552s1c1
Sequence:CCGGCCAAAGTTCGTCCCTAAGGTTCTCGAGAACCTTAGGGACGAACTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-2455s1c1
Sequence:CCGGCGACTCATCGAACGGTTACATCTCGAGATGTAACCGTTCGATGAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019777.2-1977s1c1
Sequence:CCGGCCAGAAGATTCAGTGTTGTTTCTCGAGAAACAACACTGAATCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-2400s1c1
Sequence:CCGGGCAGGAGCTTTGTAATGATATCTCGAGATATCATTACAAAGCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2453s21c1
Sequence:CCGGCGACTCATCGAACGGTTACATCTCGAGATGTAACCGTTCGATGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2632s21c1
Sequence:CCGGTTGGCCAACAAACTAGCATTACTCGAGTAATGCTAGTTTGTTGGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2074s21c1
Sequence:CCGGCCACAAGCTGGATAAGGTAAACTCGAGTTTACCTTATCCAGCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019777.3-2398s21c1
Sequence:CCGGGCAGGAGCTTTGTAATGATATCTCGAGATATCATTACAAAGCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-1567s21c1
Sequence:CCGGGGTTGACCTACAGGCCGATTACTCGAGTAATCGGCCTGTAGGTCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019777
VALIDATED
IKBKE MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-838s1c1
Sequence:CCGGCTGGACGATGATGAGAAGTTTCTCGAGAAACTTCTCATCATCGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019777.2-1552s1c1
Sequence:CCGGCCAAAGTTCGTCCCTAAGGTTCTCGAGAACCTTAGGGACGAACTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-2455s1c1
Sequence:CCGGCGACTCATCGAACGGTTACATCTCGAGATGTAACCGTTCGATGAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019777.2-1977s1c1
Sequence:CCGGCCAGAAGATTCAGTGTTGTTTCTCGAGAAACAACACTGAATCTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019777.2-2400s1c1
Sequence:CCGGGCAGGAGCTTTGTAATGATATCTCGAGATATCATTACAAAGCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2453s21c1
Sequence:CCGGCGACTCATCGAACGGTTACATCTCGAGATGTAACCGTTCGATGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2632s21c1
Sequence:CCGGTTGGCCAACAAACTAGCATTACTCGAGTAATGCTAGTTTGTTGGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-2074s21c1
Sequence:CCGGCCACAAGCTGGATAAGGTAAACTCGAGTTTACCTTATCCAGCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019777.3-2398s21c1
Sequence:CCGGGCAGGAGCTTTGTAATGATATCTCGAGATATCATTACAAAGCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019777.3-1567s21c1
Sequence:CCGGGGTTGACCTACAGGCCGATTACTCGAGTAATCGGCCTGTAGGTCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)