EMAIL THIS PAGE TO A FRIEND

IKBKG

inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma

185 Gene Product Result for
Synonyms: AMCBX1 FIP-3 FIP3 Fip3p IKK-gamma IP IP1 IP2 IPD2 NEMO ZC2HC9
UniProtKB ID: Q9Y6K9, Q7LBY6, Q7Z7F1
Gene ID:
Human(8517) Summary: This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Aug 2011]
Mouse(16151) inhibitor of kappaB kinase gamma
Rat(309295) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Zebrafish(541530) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
cow(281855) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
domestic cat(101086544) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
dog(612576) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
domestic guinea pig(100722308) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
naked mole-rat(101712077) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
sheep(101107332) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Domestic Rabbit(100328905) inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000426 Anti-IKBKG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV30005 Anti-IKBKG antibody produced in rabbit IgG fraction of antiserum bovine, rat, guinea pig, rabbit, human, canine, mouse, horse
western blot pricing
SAB2103956 Anti-IKBKG, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rat, rabbit, mouse, rabbit, horse, guinea pig, pig, bovine
western blot pricing
SAB4503403 Anti-IKK-γ antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4503404 Anti-IKK-γ antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB3500414 Anti-IKKγ antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, western blot pricing
I5032 Anti-IKKγ/NEMO (C-Terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB1303558 ANTI-MOUSE PHOSPHO-IKKG-S375 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
GW21172 Anti-NEMO antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB4503884 Anti-phospho-IKK-γ (pSer31) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301464 Anti-phospho-IKK-γ (pSer31) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4301294 Anti-phospho-IKK-γ (pSer376) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504280 Anti-phospho-IKK-γ (pSer85) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301427 Anti-phospho-IKK-γ (pSer85) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
WH0008517M1 Monoclonal Anti-IKBKG antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB1404591 Monoclonal Anti-IKBKG, (N-terminal) antibody produced in mouse clone 1D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1305531 MONOCLONAL ANTI-IKK GAMMA antibody produced in mouse clone 55AT986.5.78, IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0667 Parthenolide ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003639 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032271 MISSION® esiRNA esiRNA human IKBKG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099856 Rosetta Predictions human pricing
NM_001099857 Rosetta Predictions human pricing
NM_003639 Rosetta Predictions human pricing
NM_199103 Rosetta Predictions rat pricing
XM_579731 Rosetta Predictions rat pricing
NM_010547 Rosetta Predictions mouse pricing
NM_178590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321554 predicted 530
2 SASI_Hs02_00321555 predicted 906
3 SASI_Hs02_00321556 predicted 1050
4 SASI_Hs02_00321557 predicted 988
5 SASI_Hs02_00321558 predicted 903
6 SASI_Hs02_00321559 predicted 1053
7 SASI_Hs02_00321560 predicted 408
8 SASI_Hs02_00321561 predicted 929
9 SASI_Hs02_00321562 predicted 1047
10 SASI_Hs02_00321563 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321564 predicted 725
2 SASI_Hs02_00321565 predicted 1091
3 SASI_Hs02_00321566 predicted 1237
4 SASI_Hs02_00321567 predicted 1176
5 SASI_Hs02_00321568 predicted 1093
6 SASI_Hs02_00321569 predicted 1239
7 SASI_Hs02_00321570 predicted 597
8 SASI_Hs02_00321571 predicted 1119
9 SASI_Hs02_00321572 predicted 1239
10 SASI_Hs02_00321573 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099711 predicted 566
2 SASI_Hs01_00099713 predicted 938
3 SASI_Hs01_00099714 predicted 1082
4 SASI_Hs01_00099715 predicted 1027
5 SASI_Hs01_00099716 predicted 940
6 SASI_Hs01_00099717 predicted 1089
7 SASI_Hs01_00099718 predicted 440
8 SASI_Hs01_00099719 predicted 963
9 SASI_Hs01_00099720 predicted 1084
10 SASI_Hs02_00335996 predicted 1668
11 SASI_Hs01_00099712 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055455 predicted 804
2 SASI_Rn01_00055456 predicted 480
3 SASI_Rn01_00055457 predicted 983
4 SASI_Rn01_00055458 predicted 195
5 SASI_Rn01_00055459 predicted 202
6 SASI_Rn02_00270122 predicted 740
7 SASI_Rn01_00055460 predicted 495
8 SASI_Rn02_00270123 predicted 490
9 SASI_Rn01_00055461 predicted 673
10 SASI_Rn01_00055462 predicted 704
11 SASI_Rn01_00055454 predicted 487
12 SASI_Rn01_00055463 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144539 predicted 308
2 SASI_Rn01_00144540 predicted 634
3 SASI_Rn01_00144541 predicted 301
4 SASI_Rn01_00144542 predicted 302
5 SASI_Rn01_00144543 predicted 809
6 SASI_Rn01_00144544 predicted 312
7 SASI_Rn01_00144545 predicted 313
8 SASI_Rn01_00144546 predicted 498
9 SASI_Rn01_00144547 predicted 527
10 SASI_Rn01_00144548 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082840 predicted 1004
2 SASI_Mm01_00082841 predicted 1104
3 SASI_Mm01_00082842 predicted 1167
4 SASI_Mm02_00318802 predicted 1110
5 SASI_Mm01_00082843 predicted 923
6 SASI_Mm02_00318803 predicted 1003
7 SASI_Mm02_00318804 predicted 1161
8 SASI_Mm01_00082845 predicted 1054
9 SASI_Mm01_00082846 predicted 1036
10 SASI_Mm01_00082847 predicted 1034
11 SASI_Mm01_00082844 predicted 1020
12 SASI_Mm01_00082848 predicted 945
13 SASI_Mm01_00082849 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113155 predicted 1114
2 SASI_Mm01_00113156 predicted 1220
3 SASI_Mm01_00113157 predicted 1284
4 SASI_Mm02_00348902 predicted 1216
5 SASI_Mm01_00113158 predicted 1037
6 SASI_Mm02_00348903 predicted 1116
7 SASI_Mm02_00348904 predicted 1276
8 SASI_Mm01_00113160 predicted 1162
9 SASI_Mm01_00113161 predicted 1157
10 SASI_Mm01_00113162 predicted 1148
11 SASI_Mm01_00113159 predicted 1139
12 SASI_Mm01_00113163 predicted 1066
13 SASI_Mm01_00113164 predicted 1265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010547
VALIDATED
IKBKG MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-376s21c1
Sequence:CCGGGCCTTAAAGGAGTTGGAGCAACTCGAGTTGCTCCAACTCCTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010547.1-1333s21c1
Sequence:CCGGCCACACTTAAGGGCTTGCTTTCTCGAGAAAGCAAGCCCTTAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-732s21c1
Sequence:CCGGAGACTACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-817s21c1
Sequence:CCGGGTAGCCAAACAGGAATTGATTCTCGAGAATCAATTCCTGTTTGGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010547.1-1333s1c1
Sequence:CCGGCCACACTTAAGGGCTTGCTTTCTCGAGAAAGCAAGCCCTTAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010547.1-1204s1c1
Sequence:CCGGGCTCCTGATATGGACACTCTACTCGAGTAGAGTGTCCATATCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-376s1c1
Sequence:CCGGGCCTTAAAGGAGTTGGAGCAACTCGAGTTGCTCCAACTCCTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-732s1c1
Sequence:CCGGAGACTACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-817s1c1
Sequence:CCGGGTAGCCAAACAGGAATTGATTCTCGAGAATCAATTCCTGTTTGGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010547
VALIDATED
IKBKG MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-376s21c1
Sequence:CCGGGCCTTAAAGGAGTTGGAGCAACTCGAGTTGCTCCAACTCCTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010547.1-1333s21c1
Sequence:CCGGCCACACTTAAGGGCTTGCTTTCTCGAGAAAGCAAGCCCTTAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-732s21c1
Sequence:CCGGAGACTACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-817s21c1
Sequence:CCGGGTAGCCAAACAGGAATTGATTCTCGAGAATCAATTCCTGTTTGGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010547.1-1333s1c1
Sequence:CCGGCCACACTTAAGGGCTTGCTTTCTCGAGAAAGCAAGCCCTTAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010547.1-1204s1c1
Sequence:CCGGGCTCCTGATATGGACACTCTACTCGAGTAGAGTGTCCATATCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-376s1c1
Sequence:CCGGGCCTTAAAGGAGTTGGAGCAACTCGAGTTGCTCCAACTCCTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-732s1c1
Sequence:CCGGAGACTACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-817s1c1
Sequence:CCGGGTAGCCAAACAGGAATTGATTCTCGAGAATCAATTCCTGTTTGGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010547
VALIDATED
IKBKG MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-376s21c1
Sequence:CCGGGCCTTAAAGGAGTTGGAGCAACTCGAGTTGCTCCAACTCCTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010547.1-1333s21c1
Sequence:CCGGCCACACTTAAGGGCTTGCTTTCTCGAGAAAGCAAGCCCTTAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-732s21c1
Sequence:CCGGAGACTACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010547.1-817s21c1
Sequence:CCGGGTAGCCAAACAGGAATTGATTCTCGAGAATCAATTCCTGTTTGGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010547.1-1333s1c1
Sequence:CCGGCCACACTTAAGGGCTTGCTTTCTCGAGAAAGCAAGCCCTTAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010547.1-1204s1c1
Sequence:CCGGGCTCCTGATATGGACACTCTACTCGAGTAGAGTGTCCATATCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-376s1c1
Sequence:CCGGGCCTTAAAGGAGTTGGAGCAACTCGAGTTGCTCCAACTCCTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-732s1c1
Sequence:CCGGAGACTACGACAGCCACATTAACTCGAGTTAATGTGGCTGTCGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010547.1-817s1c1
Sequence:CCGGGTAGCCAAACAGGAATTGATTCTCGAGAATCAATTCCTGTTTGGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003639
VALIDATED
IKBKG MISSION shRNA Bacterial Glycerol Stock
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003639.3-1774s21c1
Sequence:CCGGACCACTTGCCTCGGGCTAATCCTCGAGGATTAGCCCGAGGCAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1086s21c1
Sequence:CCGGCAAACAGGAGGTGATCGATAACTCGAGTTATCGATCACCTCCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1475s21c1
Sequence:CCGGATATGGACACCCTGCAGATACCTCGAGGTATCTGCAGGGTGTCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1031s21c1
Sequence:CCGGTGCAGCTGGAAGATCTCAAACCTCGAGGTTTGAGATCTTCCAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1447s21c1
Sequence:CCGGTGTCCCAAGTGCCAGTATCAGCTCGAGCTGATACTGGCACTTGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003639.2-973s1c1
Sequence:CCGGCCAAGAATACGACAACCACATCTCGAGATGTGGTTGTCGTATTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-1126s1c1
Sequence:CCGGGCAGCACAAGATTGTGATGGACTCGAGTCCATCACAATCTTGTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-1270s1c1
Sequence:CCGGGAGGGAGTACAGCAAACTGAACTCGAGTTCAGTTTGCTGTACTCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003639.2-428s1c1
Sequence:CCGGGAGAATCAAGAGCTCCGAGATCTCGAGATCTCGGAGCTCTTGATTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-592s1c1
Sequence:CCGGGCTCGATCTGAAGAGGCAGAACTCGAGTTCTGCCTCTTCAGATCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003639
VALIDATED
IKBKG MISSION shRNA shRNA Plasmid DNA
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003639.3-1774s21c1
Sequence:CCGGACCACTTGCCTCGGGCTAATCCTCGAGGATTAGCCCGAGGCAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1086s21c1
Sequence:CCGGCAAACAGGAGGTGATCGATAACTCGAGTTATCGATCACCTCCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1475s21c1
Sequence:CCGGATATGGACACCCTGCAGATACCTCGAGGTATCTGCAGGGTGTCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1031s21c1
Sequence:CCGGTGCAGCTGGAAGATCTCAAACCTCGAGGTTTGAGATCTTCCAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1447s21c1
Sequence:CCGGTGTCCCAAGTGCCAGTATCAGCTCGAGCTGATACTGGCACTTGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003639.2-973s1c1
Sequence:CCGGCCAAGAATACGACAACCACATCTCGAGATGTGGTTGTCGTATTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-1126s1c1
Sequence:CCGGGCAGCACAAGATTGTGATGGACTCGAGTCCATCACAATCTTGTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-1270s1c1
Sequence:CCGGGAGGGAGTACAGCAAACTGAACTCGAGTTCAGTTTGCTGTACTCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003639.2-428s1c1
Sequence:CCGGGAGAATCAAGAGCTCCGAGATCTCGAGATCTCGGAGCTCTTGATTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-592s1c1
Sequence:CCGGGCTCGATCTGAAGAGGCAGAACTCGAGTTCTGCCTCTTCAGATCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003639
VALIDATED
IKBKG MISSION shRNA Lentiviral Transduction Particles
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003639.3-1774s21c1
Sequence:CCGGACCACTTGCCTCGGGCTAATCCTCGAGGATTAGCCCGAGGCAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1086s21c1
Sequence:CCGGCAAACAGGAGGTGATCGATAACTCGAGTTATCGATCACCTCCTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1475s21c1
Sequence:CCGGATATGGACACCCTGCAGATACCTCGAGGTATCTGCAGGGTGTCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1031s21c1
Sequence:CCGGTGCAGCTGGAAGATCTCAAACCTCGAGGTTTGAGATCTTCCAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003639.3-1447s21c1
Sequence:CCGGTGTCCCAAGTGCCAGTATCAGCTCGAGCTGATACTGGCACTTGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003639.2-973s1c1
Sequence:CCGGCCAAGAATACGACAACCACATCTCGAGATGTGGTTGTCGTATTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-1126s1c1
Sequence:CCGGGCAGCACAAGATTGTGATGGACTCGAGTCCATCACAATCTTGTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-1270s1c1
Sequence:CCGGGAGGGAGTACAGCAAACTGAACTCGAGTTCAGTTTGCTGTACTCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003639.2-428s1c1
Sequence:CCGGGAGAATCAAGAGCTCCGAGATCTCGAGATCTCGGAGCTCTTGATTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003639.2-592s1c1
Sequence:CCGGGCTCGATCTGAAGAGGCAGAACTCGAGTTCTGCCTCTTCAGATCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)