EMAIL THIS PAGE TO A FRIEND

IKZF1

IKAROS family zinc finger 1 (Ikaros)

67 Gene Product Result for
Synonyms: Hs.54452 IK1 IKAROS LYF1 PRO0758 ZNFN1A1 hIk-1
Gene ID:
Human(10320) Summary: This gene encodes a transcription factor that belongs to the family of zinc-finger DNA binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. All isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homodimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and contain the nuclear localization signal, resulting in members with and without DNA-binding properties. Only few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and thought to function as dominant negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2011]
Mouse(22778) IKAROS family zinc finger 1
Rat(305501) IKAROS family zinc finger 1
Zebrafish(30177) IKAROS family zinc finger 1 (Ikaros)
Horse(100052437) IKAROS family zinc finger 1 (Ikaros)
cow(541154) IKAROS family zinc finger 1 (Ikaros)
domestic cat(101085701) IKAROS family zinc finger 1 (Ikaros)
dog(483231) IKAROS family zinc finger 1 (Ikaros)
chicken(395974) IKAROS family zinc finger 1 (Ikaros)
sheep(101107435) IKAROS family zinc finger 1 (Ikaros)
Domestic Rabbit(100356499) IKAROS family zinc finger 1 (Ikaros)
domestic guinea pig(100734033) IKAROS family zinc finger 1 (Ikaros)
naked mole-rat(101699759) IKAROS family zinc finger 1 (Ikaros)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500120 Anti-IKAROS antibody, Rabbit monoclonal clone SP108, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB2501332 Anti-IKZF1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, canine, human, bovine, bovine
ELISA, immunohistochemistry, western blot pricing
SAB1408751 Anti-IKZF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2101144 Anti-IKZF1 antibody produced in rabbit affinity isolated antibody canine, rat, human, horse, rabbit, mouse, bovine, guinea pig
western blot pricing
HPA035221 Anti-IKZF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
HPA035222 Anti-IKZF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB2104298 Anti-IKZF1 antibody produced in rabbit affinity isolated antibody human, canine, horse, bovine, mouse, rabbit, rat, guinea pig
western blot pricing
SAB2107305 Anti-IKZF1 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human, mouse
ELISA, western blot pricing
SAB2500535 Anti-IKZF1/IKAROS antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
AV32757 Anti-ZNFN1A1 antibody produced in rabbit affinity isolated antibody bovine, pig, rabbit, mouse, rat, canine, human
immunohistochemistry, western blot pricing
SAB4200366 Monoclonal Anti-IKZF1/IKAROS antibody produced in mouse ~1.0 mg/mL, clone E1.14, purified immunoglobulin mouse, monkey, human, rat
flow cytometry, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006060 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156861 MISSION® esiRNA esiRNA human IKZF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006060 Rosetta Predictions human pricing
NM_001107237 Rosetta Predictions rat pricing
NM_001025597 Rosetta Predictions mouse pricing
NM_009578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025059 predicted 863
2 SASI_Hs01_00025060 predicted 309
3 SASI_Hs01_00025061 predicted 1544
4 SASI_Hs01_00025062 predicted 475
5 SASI_Hs01_00025063 predicted 518
6 SASI_Hs01_00025064 predicted 638
7 SASI_Hs01_00025065 predicted 978
8 SASI_Hs01_00025066 predicted 412
9 SASI_Hs01_00025067 predicted 1175
10 SASI_Hs01_00025068 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226865 predicted 772
2 SASI_Rn02_00226866 predicted 556
3 SASI_Rn02_00226867 predicted 226
4 SASI_Rn02_00226868 predicted 1447
5 SASI_Rn02_00226869 predicted 529
6 SASI_Rn02_00226870 predicted 1316
7 SASI_Rn02_00226871 predicted 812
8 SASI_Rn02_00226872 predicted 791
9 SASI_Rn02_00226873 predicted 1521
10 SASI_Rn02_00226874 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065776 predicted 1093
2 SASI_Mm01_00065777 predicted 1068
3 SASI_Mm02_00287954 predicted 1756
4 SASI_Mm01_00065778 predicted 1478
5 SASI_Mm01_00065779 predicted 1631
6 SASI_Mm01_00065780 predicted 1114
7 SASI_Mm01_00065781 predicted 1519
8 SASI_Mm01_00065782 predicted 1418
9 SASI_Mm01_00065783 predicted 1132
10 SASI_Mm01_00065784 predicted 892
11 SASI_Mm01_00065785 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119753 predicted 834
2 SASI_Mm01_00119754 predicted 811
3 SASI_Mm02_00316471 predicted 1494
4 SASI_Mm01_00119755 predicted 1216
5 SASI_Mm01_00119756 predicted 1370
6 SASI_Mm01_00119757 predicted 850
7 SASI_Mm01_00119758 predicted 1258
8 SASI_Mm01_00119759 predicted 1162
9 SASI_Mm01_00119760 predicted 878
10 SASI_Mm01_00119761 predicted 634
11 SASI_Mm01_00119762 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009578
IKZF1 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 1 (Ikaros)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009578.1-1355s1c1
Sequence:CCGGAGCACAAAGATAGCTGGTTATCTCGAGATAACCAGCTATCTTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-992s1c1
Sequence:CCGGCGGCCTTATCTACCTAACCAACTCGAGTTGGTTAGGTAGATAAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-484s1c1
Sequence:CCGGGCCCAGTCATTAAGGAAGAAACTCGAGTTTCTTCCTTAATGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-647s1c1
Sequence:CCGGGCCCTATGACAGTGCCAACTACTCGAGTAGTTGGCACTGTCATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-364s1c1
Sequence:CCGGCCGTTGGTAAGCCTCACAAATCTCGAGATTTGTGAGGCTTACCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009578.2-649s21c1
Sequence:CCGGAGCTCTTTAGAGGAGCATAAACTCGAGTTTATGCTCCTCTAAAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009578.2-2007s21c1
Sequence:CCGGGAGCCAGAGGACCAGATATAACTCGAGTTATATCTGGTCCTCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009578.2-622s21c1
Sequence:CCGGTATTGTGGCCGGAGCTATAAACTCGAGTTTATAGCTCCGGCCACAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009578.2-1913s21c1
Sequence:CCGGTTGCCCTAAGCAGAGTTTATGCTCGAGCATAAACTCTGCTTAGGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009578
IKZF1 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 1 (Ikaros)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009578.1-1355s1c1
Sequence:CCGGAGCACAAAGATAGCTGGTTATCTCGAGATAACCAGCTATCTTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-992s1c1
Sequence:CCGGCGGCCTTATCTACCTAACCAACTCGAGTTGGTTAGGTAGATAAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-484s1c1
Sequence:CCGGGCCCAGTCATTAAGGAAGAAACTCGAGTTTCTTCCTTAATGACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-647s1c1
Sequence:CCGGGCCCTATGACAGTGCCAACTACTCGAGTAGTTGGCACTGTCATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-364s1c1
Sequence:CCGGCCGTTGGTAAGCCTCACAAATCTCGAGATTTGTGAGGCTTACCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009578.2-649s21c1
Sequence:CCGGAGCTCTTTAGAGGAGCATAAACTCGAGTTTATGCTCCTCTAAAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009578.2-2007s21c1
Sequence:CCGGGAGCCAGAGGACCAGATATAACTCGAGTTATATCTGGTCCTCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009578.2-622s21c1
Sequence:CCGGTATTGTGGCCGGAGCTATAAACTCGAGTTTATAGCTCCGGCCACAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009578.2-1913s21c1
Sequence:CCGGTTGCCCTAAGCAGAGTTTATGCTCGAGCATAAACTCTGCTTAGGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009578
IKZF1 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 1 (Ikaros)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009578.1-1355s1c1
Sequence:CCGGAGCACAAAGATAGCTGGTTATCTCGAGATAACCAGCTATCTTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-992s1c1
Sequence:CCGGCGGCCTTATCTACCTAACCAACTCGAGTTGGTTAGGTAGATAAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-484s1c1
Sequence:CCGGGCCCAGTCATTAAGGAAGAAACTCGAGTTTCTTCCTTAATGACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-647s1c1
Sequence:CCGGGCCCTATGACAGTGCCAACTACTCGAGTAGTTGGCACTGTCATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009578.1-364s1c1
Sequence:CCGGCCGTTGGTAAGCCTCACAAATCTCGAGATTTGTGAGGCTTACCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009578.2-649s21c1
Sequence:CCGGAGCTCTTTAGAGGAGCATAAACTCGAGTTTATGCTCCTCTAAAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009578.2-2007s21c1
Sequence:CCGGGAGCCAGAGGACCAGATATAACTCGAGTTATATCTGGTCCTCTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009578.2-622s21c1
Sequence:CCGGTATTGTGGCCGGAGCTATAAACTCGAGTTTATAGCTCCGGCCACAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009578.2-1913s21c1
Sequence:CCGGTTGCCCTAAGCAGAGTTTATGCTCGAGCATAAACTCTGCTTAGGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006060
VALIDATED
IKZF1 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 1 (Ikaros)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006060.2-3248s1c1
Sequence:CCGGGCTATCAATCATTAAGGTCATCTCGAGATGACCTTAATGATTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-981s1c1
Sequence:CCGGCGCCAAACGTAAGAGCTCTATCTCGAGATAGAGCTCTTACGTTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-403s1c1
Sequence:CCGGGCGGAGGATTTACGAATGCTTCTCGAGAAGCATTCGTAAATCCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-755s1c1
Sequence:CCGGCCGTTGGTAAACCTCACAAATCTCGAGATTTGTGAGGTTTACCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-788s1c1
Sequence:CCGGGCCGAAGCTATAAACAGCGAACTCGAGTTCGCTGTTTATAGCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-1062s21c1
Sequence:CCGGCTACGAGAAGGAGAACGAAATCTCGAGATTTCGTTCTCCTTCTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-781s21c1
Sequence:CCGGTATTGTGGCCGAAGCTATAAACTCGAGTTTATAGCTTCGGCCACAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006060.3-3884s21c1
Sequence:CCGGGCATTTGGAAACGGGAATAAACTCGAGTTTATTCCCGTTTCCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-1710s21c1
Sequence:CCGGCCGCTTCCACATGAGCTAAAGCTCGAGCTTTAGCTCATGTGGAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-524s21c1
Sequence:CCGGGTGATATCTGTGGGATCATTTCTCGAGAAATGATCCCACAGATATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006060
VALIDATED
IKZF1 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 1 (Ikaros)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006060.2-3248s1c1
Sequence:CCGGGCTATCAATCATTAAGGTCATCTCGAGATGACCTTAATGATTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-981s1c1
Sequence:CCGGCGCCAAACGTAAGAGCTCTATCTCGAGATAGAGCTCTTACGTTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-403s1c1
Sequence:CCGGGCGGAGGATTTACGAATGCTTCTCGAGAAGCATTCGTAAATCCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-755s1c1
Sequence:CCGGCCGTTGGTAAACCTCACAAATCTCGAGATTTGTGAGGTTTACCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-788s1c1
Sequence:CCGGGCCGAAGCTATAAACAGCGAACTCGAGTTCGCTGTTTATAGCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-1062s21c1
Sequence:CCGGCTACGAGAAGGAGAACGAAATCTCGAGATTTCGTTCTCCTTCTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-781s21c1
Sequence:CCGGTATTGTGGCCGAAGCTATAAACTCGAGTTTATAGCTTCGGCCACAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006060.3-3884s21c1
Sequence:CCGGGCATTTGGAAACGGGAATAAACTCGAGTTTATTCCCGTTTCCAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-1710s21c1
Sequence:CCGGCCGCTTCCACATGAGCTAAAGCTCGAGCTTTAGCTCATGTGGAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-524s21c1
Sequence:CCGGGTGATATCTGTGGGATCATTTCTCGAGAAATGATCCCACAGATATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006060
VALIDATED
IKZF1 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 1 (Ikaros)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006060.2-3248s1c1
Sequence:CCGGGCTATCAATCATTAAGGTCATCTCGAGATGACCTTAATGATTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-981s1c1
Sequence:CCGGCGCCAAACGTAAGAGCTCTATCTCGAGATAGAGCTCTTACGTTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-403s1c1
Sequence:CCGGGCGGAGGATTTACGAATGCTTCTCGAGAAGCATTCGTAAATCCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-755s1c1
Sequence:CCGGCCGTTGGTAAACCTCACAAATCTCGAGATTTGTGAGGTTTACCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006060.2-788s1c1
Sequence:CCGGGCCGAAGCTATAAACAGCGAACTCGAGTTCGCTGTTTATAGCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-1062s21c1
Sequence:CCGGCTACGAGAAGGAGAACGAAATCTCGAGATTTCGTTCTCCTTCTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-781s21c1
Sequence:CCGGTATTGTGGCCGAAGCTATAAACTCGAGTTTATAGCTTCGGCCACAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006060.3-3884s21c1
Sequence:CCGGGCATTTGGAAACGGGAATAAACTCGAGTTTATTCCCGTTTCCAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-1710s21c1
Sequence:CCGGCCGCTTCCACATGAGCTAAAGCTCGAGCTTTAGCTCATGTGGAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006060.3-524s21c1
Sequence:CCGGGTGATATCTGTGGGATCATTTCTCGAGAAATGATCCCACAGATATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)