EMAIL THIS PAGE TO A FRIEND

IKZF2

IKAROS family zinc finger 2 (Helios)

358 Gene Product Result for
Synonyms: ANF1A2 HELIOS ZNF1A2 ZNFN1A2
UniProtKB ID: Q9UKS7, Q8N6S1
Gene ID:
Human(22807) Summary: This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(22779) IKAROS family zinc finger 2
Rat(301476) IKAROS family zinc finger 2
domestic guinea pig(100731310) IKAROS family zinc finger 2 (Helios)
naked mole-rat(101724785) IKAROS family zinc finger 2 (Helios)
sheep(101103788) IKAROS family zinc finger 2 (Helios)
Domestic Rabbit(100345499) IKAROS family zinc finger 2 (Helios)
chicken(395309) IKAROS family zinc finger 2 (Helios)
cow(786795) IKAROS family zinc finger 2 (Helios)
Horse(100050253) IKAROS family zinc finger 2 (Helios)
domestic cat(101100826) IKAROS family zinc finger 2 (Helios)
dog(488510) IKAROS family zinc finger 2 (Helios)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079526 Rosetta Predictions human pricing
NM_016260 Rosetta Predictions human pricing
NM_001106916 Rosetta Predictions rat pricing
NM_011770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313480 predicted 1309
2 SASI_Hs02_00313481 predicted 979
3 SASI_Hs02_00313482 predicted 1296
4 SASI_Hs02_00313483 predicted 1633
5 SASI_Hs02_00313484 predicted 1589
6 SASI_Hs02_00313485 predicted 983
7 SASI_Hs02_00313486 predicted 1112
8 SASI_Hs02_00313487 predicted 1695
9 SASI_Hs02_00313488 predicted 1279
10 SASI_Hs02_00313489 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107471 predicted 1240
2 SASI_Hs02_00349142 predicted 907
3 SASI_Hs02_00349143 predicted 1226
4 SASI_Hs02_00349144 predicted 1558
5 SASI_Hs01_00107476 predicted 1526
6 SASI_Hs02_00349145 predicted 911
7 SASI_Hs02_00349146 predicted 1045
8 SASI_Hs02_00349147 predicted 1621
9 SASI_Hs02_00349148 predicted 1208
10 SASI_Hs02_00349149 predicted 1525
11 SASI_Hs01_00107470 predicted 298
12 SASI_Hs01_00107472 predicted 1043
13 SASI_Hs01_00107473 predicted 623
14 SASI_Hs01_00107474 predicted 472
15 SASI_Hs01_00107475 predicted 317
16 SASI_Hs01_00107477 predicted 299
17 SASI_Hs01_00107478 predicted 543
18 SASI_Hs01_00107479 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223666 predicted 727
2 SASI_Rn02_00223667 predicted 514
3 SASI_Rn02_00223668 predicted 215
4 SASI_Rn02_00223669 predicted 647
5 SASI_Rn02_00223670 predicted 962
6 SASI_Rn02_00223671 predicted 723
7 SASI_Rn02_00223672 predicted 516
8 SASI_Rn02_00223673 predicted 728
9 SASI_Rn02_00223674 predicted 697
10 SASI_Rn02_00223675 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123452 predicted 1490
2 SASI_Mm01_00123453 predicted 1350
3 SASI_Mm01_00123454 predicted 853
4 SASI_Mm01_00123455 predicted 586
5 SASI_Mm01_00123456 predicted 1323
6 SASI_Mm01_00123457 predicted 1337
7 SASI_Mm01_00123458 predicted 1502
8 SASI_Mm01_00123459 predicted 1351
9 SASI_Mm01_00123460 predicted 1092
10 SASI_Mm01_00123461 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011770
IKZF2 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 2 (Helios)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011770.4-2065s21c1
Sequence:CCGGATGATAACTTGGCTTGTTTATCTCGAGATAAACAAGCCAAGTTATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-1804s21c1
Sequence:CCGGAGCCAGGACCGCTACGAATTTCTCGAGAAATTCGTAGCGGTCCTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011770.4-2124s21c1
Sequence:CCGGCCTTGTTAAGGCCTATCATAACTCGAGTTATGATAGGCCTTAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-859s21c1
Sequence:CCGGGGTAAACCTCACAAGTGTAACCTCGAGGTTACACTTGTGAGGTTTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-740s21c1
Sequence:CCGGGCAACCTTCTGAGACACATAACTCGAGTTATGTGTCTCAGAAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011770.2-2650s1c1
Sequence:CCGGCGTCACTTTATCAGCATTCAACTCGAGTTGAATGCTGATAAAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1015s1c1
Sequence:CCGGCGATTCAGCTACCCAGATATTCTCGAGAATATCTGGGTAGCTGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1357s1c1
Sequence:CCGGCTCGATTCTACTGACTCAGAACTCGAGTTCTGAGTCAGTAGAATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-889s1c1
Sequence:CCGGCCTATCATGGACAACAATATTCTCGAGAATATTGTTGTCCATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1417s1c1
Sequence:CCGGGCCTTAAATCCCAAGAGGAAACTCGAGTTTCCTCTTGGGATTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-1080s21c1
Sequence:CCGGAGAGAAGCTCACGGCAAATATCTCGAGATATTTGCCGTGAGCTTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011770
IKZF2 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 2 (Helios)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011770.4-2065s21c1
Sequence:CCGGATGATAACTTGGCTTGTTTATCTCGAGATAAACAAGCCAAGTTATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-1804s21c1
Sequence:CCGGAGCCAGGACCGCTACGAATTTCTCGAGAAATTCGTAGCGGTCCTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011770.4-2124s21c1
Sequence:CCGGCCTTGTTAAGGCCTATCATAACTCGAGTTATGATAGGCCTTAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-859s21c1
Sequence:CCGGGGTAAACCTCACAAGTGTAACCTCGAGGTTACACTTGTGAGGTTTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-740s21c1
Sequence:CCGGGCAACCTTCTGAGACACATAACTCGAGTTATGTGTCTCAGAAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011770.2-2650s1c1
Sequence:CCGGCGTCACTTTATCAGCATTCAACTCGAGTTGAATGCTGATAAAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1015s1c1
Sequence:CCGGCGATTCAGCTACCCAGATATTCTCGAGAATATCTGGGTAGCTGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1357s1c1
Sequence:CCGGCTCGATTCTACTGACTCAGAACTCGAGTTCTGAGTCAGTAGAATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-889s1c1
Sequence:CCGGCCTATCATGGACAACAATATTCTCGAGAATATTGTTGTCCATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1417s1c1
Sequence:CCGGGCCTTAAATCCCAAGAGGAAACTCGAGTTTCCTCTTGGGATTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-1080s21c1
Sequence:CCGGAGAGAAGCTCACGGCAAATATCTCGAGATATTTGCCGTGAGCTTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011770
IKZF2 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 2 (Helios)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011770.4-2065s21c1
Sequence:CCGGATGATAACTTGGCTTGTTTATCTCGAGATAAACAAGCCAAGTTATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-1804s21c1
Sequence:CCGGAGCCAGGACCGCTACGAATTTCTCGAGAAATTCGTAGCGGTCCTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011770.4-2124s21c1
Sequence:CCGGCCTTGTTAAGGCCTATCATAACTCGAGTTATGATAGGCCTTAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-859s21c1
Sequence:CCGGGGTAAACCTCACAAGTGTAACCTCGAGGTTACACTTGTGAGGTTTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-740s21c1
Sequence:CCGGGCAACCTTCTGAGACACATAACTCGAGTTATGTGTCTCAGAAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011770.2-2650s1c1
Sequence:CCGGCGTCACTTTATCAGCATTCAACTCGAGTTGAATGCTGATAAAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1015s1c1
Sequence:CCGGCGATTCAGCTACCCAGATATTCTCGAGAATATCTGGGTAGCTGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1357s1c1
Sequence:CCGGCTCGATTCTACTGACTCAGAACTCGAGTTCTGAGTCAGTAGAATCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-889s1c1
Sequence:CCGGCCTATCATGGACAACAATATTCTCGAGAATATTGTTGTCCATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011770.2-1417s1c1
Sequence:CCGGGCCTTAAATCCCAAGAGGAAACTCGAGTTTCCTCTTGGGATTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011770.4-1080s21c1
Sequence:CCGGAGAGAAGCTCACGGCAAATATCTCGAGATATTTGCCGTGAGCTTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016260
VALIDATED
IKZF2 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 2 (Helios)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-628s21c1
Sequence:GTACCGGCAACCTTCTGAGACACATAAACTCGAGTTTATGTGTCTCAGAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-1041s21c1
Sequence:CCGGGATTCAGCTACCCAGATATTCCTCGAGGAATATCTGGGTAGCTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-541s21c1
Sequence:CCGGCAATGTGCTTATGGTACATAACTCGAGTTATGTACCATAAGCACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016260.2-4651s21c1
Sequence:CCGGCACATTGCTTTGCCCTAATTTCTCGAGAAATTAGGGCAAAGCAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-1686s21c1
Sequence:CCGGACAGAAGCCAGGACCGTTATGCTCGAGCATAACGGTCCTGGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-1213s1c1
Sequence:CCGGCCCAGTTATAAGCTCAGCTTACTCGAGTAAGCTGAGCTTATAACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-540s1c1
Sequence:CCGGCCAATGTGCTTATGGTACATACTCGAGTATGTACCATAAGCACATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016260.1-487s1c1
Sequence:CCGGGCTTCCGAATGGTAAACTGAACTCGAGTTCAGTTTACCATTCGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-1229s1c1
Sequence:CCGGGCTTATTCTCAGGTCTATCATCTCGAGATGATAGACCTGAGAATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016260.1-1671s1c1
Sequence:CCGGGCAACATCTGTGGCTACAGAACTCGAGTTCTGTAGCCACAGATGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016260
VALIDATED
IKZF2 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 2 (Helios)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-628s21c1
Sequence:GTACCGGCAACCTTCTGAGACACATAAACTCGAGTTTATGTGTCTCAGAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-1041s21c1
Sequence:CCGGGATTCAGCTACCCAGATATTCCTCGAGGAATATCTGGGTAGCTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-541s21c1
Sequence:CCGGCAATGTGCTTATGGTACATAACTCGAGTTATGTACCATAAGCACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016260.2-4651s21c1
Sequence:CCGGCACATTGCTTTGCCCTAATTTCTCGAGAAATTAGGGCAAAGCAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-1686s21c1
Sequence:CCGGACAGAAGCCAGGACCGTTATGCTCGAGCATAACGGTCCTGGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-1213s1c1
Sequence:CCGGCCCAGTTATAAGCTCAGCTTACTCGAGTAAGCTGAGCTTATAACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-540s1c1
Sequence:CCGGCCAATGTGCTTATGGTACATACTCGAGTATGTACCATAAGCACATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016260.1-487s1c1
Sequence:CCGGGCTTCCGAATGGTAAACTGAACTCGAGTTCAGTTTACCATTCGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-1229s1c1
Sequence:CCGGGCTTATTCTCAGGTCTATCATCTCGAGATGATAGACCTGAGAATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016260.1-1671s1c1
Sequence:CCGGGCAACATCTGTGGCTACAGAACTCGAGTTCTGTAGCCACAGATGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016260
VALIDATED
IKZF2 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 2 (Helios)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-628s21c1
Sequence:GTACCGGCAACCTTCTGAGACACATAAACTCGAGTTTATGTGTCTCAGAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-1041s21c1
Sequence:CCGGGATTCAGCTACCCAGATATTCCTCGAGGAATATCTGGGTAGCTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-541s21c1
Sequence:CCGGCAATGTGCTTATGGTACATAACTCGAGTTATGTACCATAAGCACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016260.2-4651s21c1
Sequence:CCGGCACATTGCTTTGCCCTAATTTCTCGAGAAATTAGGGCAAAGCAATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016260.2-1686s21c1
Sequence:CCGGACAGAAGCCAGGACCGTTATGCTCGAGCATAACGGTCCTGGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-1213s1c1
Sequence:CCGGCCCAGTTATAAGCTCAGCTTACTCGAGTAAGCTGAGCTTATAACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-540s1c1
Sequence:CCGGCCAATGTGCTTATGGTACATACTCGAGTATGTACCATAAGCACATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016260.1-487s1c1
Sequence:CCGGGCTTCCGAATGGTAAACTGAACTCGAGTTCAGTTTACCATTCGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_016260.1-1229s1c1
Sequence:CCGGGCTTATTCTCAGGTCTATCATCTCGAGATGATAGACCTGAGAATAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016260.1-1671s1c1
Sequence:CCGGGCAACATCTGTGGCTACAGAACTCGAGTTCTGTAGCCACAGATGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)