EMAIL THIS PAGE TO A FRIEND

IKZF3

IKAROS family zinc finger 3 (Aiolos)

163 Gene Product Result for
Synonyms: AIO AIOLOS ZNFN1A3
Gene ID:
Human(22806) Summary: This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
Mouse(22780) IKAROS family zinc finger 3
Rat(303511) IKAROS family zinc finger 3
chicken(395614) IKAROS family zinc finger 3 (Aiolos)
domestic cat(101092807) IKAROS family zinc finger 3 (Aiolos)
cow(540676) IKAROS family zinc finger 3 (Aiolos)
dog(491020) IKAROS family zinc finger 3 (Aiolos)
sheep(101104255) IKAROS family zinc finger 3 (Aiolos)
domestic guinea pig(100727931) IKAROS family zinc finger 3 (Aiolos)
naked mole-rat(101703429) IKAROS family zinc finger 3 (Aiolos)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012481 Rosetta Predictions human pricing
NM_183228 Rosetta Predictions human pricing
NM_183229 Rosetta Predictions human pricing
NM_183230 Rosetta Predictions human pricing
NM_183231 Rosetta Predictions human pricing
NM_183232 Rosetta Predictions human pricing
NM_001107047 Rosetta Predictions rat pricing
NM_011771 Rosetta Predictions mouse pricing
XM_283022 Rosetta Predictions mouse pricing
XM_903035 Rosetta Predictions mouse pricing
XM_903037 Rosetta Predictions mouse pricing
XM_903038 Rosetta Predictions mouse pricing
XM_903039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097338 predicted 2063
2 SASI_Hs01_00097339 predicted 1493
3 SASI_Hs01_00097340 predicted 1637
4 SASI_Hs01_00097341 predicted 1751
5 SASI_Hs01_00097342 predicted 1668
6 SASI_Hs01_00097343 predicted 1651
7 SASI_Hs01_00097345 predicted 1616
8 SASI_Hs01_00097346 predicted 2039
9 SASI_Hs01_00097347 predicted 1228
10 SASI_Hs02_00344394 predicted 1530
11 SASI_Hs01_00097344 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072053 predicted 1903
2 SASI_Hs01_00072054 predicted 1333
3 SASI_Hs01_00072055 predicted 1471
4 SASI_Hs01_00072056 predicted 1583
5 SASI_Hs01_00072057 predicted 1506
6 SASI_Hs01_00072058 predicted 1484
7 SASI_Hs01_00072060 predicted 1451
8 SASI_Hs01_00072061 predicted 1872
9 SASI_Hs01_00072062 predicted 1064
10 SASI_Hs02_00371226 predicted 1360
11 SASI_Hs01_00072059 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149614 predicted 1950
2 SASI_Hs01_00149615 predicted 1381
3 SASI_Hs01_00149616 predicted 1520
4 SASI_Hs01_00149617 predicted 1633
5 SASI_Hs01_00149618 predicted 1556
6 SASI_Hs01_00149619 predicted 1529
7 SASI_Hs01_00149621 predicted 1498
8 SASI_Hs01_00149622 predicted 1925
9 SASI_Hs01_00149623 predicted 1117
10 SASI_Hs02_00371227 predicted 1414
11 SASI_Hs01_00149620 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181642 predicted 1947
2 SASI_Hs01_00181643 predicted 1377
3 SASI_Hs01_00181644 predicted 1524
4 SASI_Hs01_00181645 predicted 1635
5 SASI_Hs01_00181646 predicted 1554
6 SASI_Hs01_00181647 predicted 1534
7 SASI_Hs01_00181649 predicted 1502
8 SASI_Hs01_00181650 predicted 1918
9 SASI_Hs01_00181651 predicted 1113
10 SASI_Hs02_00371228 predicted 1411
11 SASI_Hs01_00181648 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059646 predicted 1783
2 SASI_Hs01_00059647 predicted 1208
3 SASI_Hs01_00059648 predicted 1351
4 SASI_Hs01_00059649 predicted 1463
5 SASI_Hs01_00059650 predicted 1390
6 SASI_Hs01_00059651 predicted 1367
7 SASI_Hs01_00059653 predicted 1334
8 SASI_Hs01_00059654 predicted 1749
9 SASI_Hs01_00059655 predicted 952
10 SASI_Hs02_00371229 predicted 1243
11 SASI_Hs01_00059652 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085543 predicted 1829
2 SASI_Hs01_00085544 predicted 1265
3 SASI_Hs01_00085545 predicted 1408
4 SASI_Hs01_00085546 predicted 1521
5 SASI_Hs01_00085547 predicted 1439
6 SASI_Hs01_00085548 predicted 1413
7 SASI_Hs01_00085550 predicted 1378
8 SASI_Hs01_00085551 predicted 1806
9 SASI_Hs01_00085552 predicted 1001
10 SASI_Hs02_00371230 predicted 1297
11 SASI_Hs01_00085549 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224966 predicted 323
2 SASI_Rn02_00224967 predicted 425
3 SASI_Rn02_00224968 predicted 415
4 SASI_Rn02_00224969 predicted 1076
5 SASI_Rn02_00224970 predicted 855
6 SASI_Rn02_00224971 predicted 207
7 SASI_Rn02_00224972 predicted 825
8 SASI_Rn02_00224973 predicted 1149
9 SASI_Rn02_00224974 predicted 427
10 SASI_Rn02_00224975 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321405 predicted 476
2 SASI_Mm02_00321406 predicted 570
3 SASI_Mm02_00321407 predicted 1302
4 SASI_Mm02_00321408 predicted 1459
5 SASI_Mm02_00321409 predicted 439
6 SASI_Mm02_00321410 predicted 1848
7 SASI_Mm02_00321411 predicted 648
8 SASI_Mm02_00321412 predicted 747
9 SASI_Mm02_00321413 predicted 994
10 SASI_Mm02_00321414 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224088 predicted 227
2 SASI_Mm01_00224089 predicted 329
3 SASI_Mm01_00224090 predicted 1066
4 SASI_Mm01_00224091 predicted 1213
5 SASI_Mm01_00224092 predicted 1604
6 SASI_Mm01_00224093 predicted 403
7 SASI_Mm01_00224094 predicted 502
8 SASI_Mm01_00224095 predicted 756
9 SASI_Mm01_00224096 predicted 916
10 SASI_Mm01_00224097 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227209 predicted 410
2 SASI_Mm01_00227210 predicted 403
3 SASI_Mm01_00227211 predicted 318
4 SASI_Mm01_00227212 predicted 667
5 SASI_Mm01_00227213 predicted 702
6 SASI_Mm01_00227214 predicted 507
7 SASI_Mm01_00227215 predicted 304
8 SASI_Mm01_00227216 predicted 290
9 SASI_Mm01_00227217 predicted 590
10 SASI_Mm01_00227218 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238815 predicted 379
2 SASI_Mm01_00238816 predicted 927
3 SASI_Mm01_00238817 predicted 241
4 SASI_Mm01_00238818 predicted 1114
5 SASI_Mm01_00238819 predicted 1080
6 SASI_Mm01_00238820 predicted 991
7 SASI_Mm01_00238821 predicted 457
8 SASI_Mm01_00238822 predicted 1049
9 SASI_Mm01_00238823 predicted 338
10 SASI_Mm01_00238824 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272107 predicted 230
2 SASI_Mm01_00272108 predicted 449
3 SASI_Mm01_00272109 predicted 992
4 SASI_Mm01_00272110 predicted 308
5 SASI_Mm01_00272111 predicted 246
6 SASI_Mm01_00272112 predicted 1177
7 SASI_Mm01_00272113 predicted 1143
8 SASI_Mm01_00272114 predicted 1063
9 SASI_Mm01_00272115 predicted 521
10 SASI_Mm01_00272116 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202740 predicted 1550
2 SASI_Mm01_00202741 predicted 1775
3 SASI_Mm01_00202742 predicted 2322
4 SASI_Mm01_00202743 predicted 1628
5 SASI_Mm01_00202744 predicted 1571
6 SASI_Mm01_00202745 predicted 2505
7 SASI_Mm01_00202746 predicted 2474
8 SASI_Mm01_00202747 predicted 2388
9 SASI_Mm01_00202748 predicted 1848
10 SASI_Mm01_00202749 predicted 1742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012481
IKZF3 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 3 (Aiolos)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-819s1c1
Sequence:CCGGGCTCTCGTACTGGACAGATTACTCGAGTAATCTGTCCAGTACGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-1502s1c1
Sequence:CCGGCGAGTGTAACATGTGTGGATACTCGAGTATCCACACATGTTACACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-308s1c1
Sequence:CCGGGCCTGAAATCCCTTACAGCTACTCGAGTAGCTGTAAGGGATTTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-899s1c1
Sequence:CCGGCCACTGCTTTGATGTCAACTACTCGAGTAGTTGACATCAAAGCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-201s1c1
Sequence:CCGGGCCAATGAAGATGAAGACATACTCGAGTATGTCTTCATCTTCATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012481.3-2049s21c1
Sequence:CCGGATCTAATCTCCCTAATCTAAACTCGAGTTTAGATTAGGGAGATTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012481.3-2071s21c1
Sequence:CCGGGACAGTCTAAGAGTAAGTAAACTCGAGTTTACTTACTCTTAGACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012481.3-538s21c1
Sequence:CCGGGTAACCTCCTCCGCCACATTACTCGAGTAATGTGGCGGAGGAGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012481
IKZF3 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 3 (Aiolos)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-819s1c1
Sequence:CCGGGCTCTCGTACTGGACAGATTACTCGAGTAATCTGTCCAGTACGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-1502s1c1
Sequence:CCGGCGAGTGTAACATGTGTGGATACTCGAGTATCCACACATGTTACACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-308s1c1
Sequence:CCGGGCCTGAAATCCCTTACAGCTACTCGAGTAGCTGTAAGGGATTTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-899s1c1
Sequence:CCGGCCACTGCTTTGATGTCAACTACTCGAGTAGTTGACATCAAAGCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-201s1c1
Sequence:CCGGGCCAATGAAGATGAAGACATACTCGAGTATGTCTTCATCTTCATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012481.3-2049s21c1
Sequence:CCGGATCTAATCTCCCTAATCTAAACTCGAGTTTAGATTAGGGAGATTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012481.3-2071s21c1
Sequence:CCGGGACAGTCTAAGAGTAAGTAAACTCGAGTTTACTTACTCTTAGACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012481.3-538s21c1
Sequence:CCGGGTAACCTCCTCCGCCACATTACTCGAGTAATGTGGCGGAGGAGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012481
IKZF3 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 3 (Aiolos)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-819s1c1
Sequence:CCGGGCTCTCGTACTGGACAGATTACTCGAGTAATCTGTCCAGTACGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-1502s1c1
Sequence:CCGGCGAGTGTAACATGTGTGGATACTCGAGTATCCACACATGTTACACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-308s1c1
Sequence:CCGGGCCTGAAATCCCTTACAGCTACTCGAGTAGCTGTAAGGGATTTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-899s1c1
Sequence:CCGGCCACTGCTTTGATGTCAACTACTCGAGTAGTTGACATCAAAGCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012481.3-201s1c1
Sequence:CCGGGCCAATGAAGATGAAGACATACTCGAGTATGTCTTCATCTTCATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012481.3-2049s21c1
Sequence:CCGGATCTAATCTCCCTAATCTAAACTCGAGTTTAGATTAGGGAGATTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012481.3-2071s21c1
Sequence:CCGGGACAGTCTAAGAGTAAGTAAACTCGAGTTTACTTACTCTTAGACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012481.3-538s21c1
Sequence:CCGGGTAACCTCCTCCGCCACATTACTCGAGTAATGTGGCGGAGGAGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011771
IKZF3 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 3 (Aiolos)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-1648s21c1
Sequence:CCGGACGTCCTCTTCCTAGATTATGCTCGAGCATAATCTAGGAAGAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011771.1-3242s21c1
Sequence:CCGGGTGCTTGCCAAGCTCATATTTCTCGAGAAATATGAGCTTGGCAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-754s21c1
Sequence:CCGGGTAACCTCCTCCGTCATATTACTCGAGTAATATGACGGAGGAGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-668s21c1
Sequence:CCGGCAACGTCTTGATGGTTCATAACTCGAGTTATGAACCATCAAGACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-475s21c1
Sequence:CCGGGCGACAGAGATGAGAACATTACTCGAGTAATGTTCTCATCTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011771
IKZF3 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 3 (Aiolos)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-1648s21c1
Sequence:CCGGACGTCCTCTTCCTAGATTATGCTCGAGCATAATCTAGGAAGAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011771.1-3242s21c1
Sequence:CCGGGTGCTTGCCAAGCTCATATTTCTCGAGAAATATGAGCTTGGCAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-754s21c1
Sequence:CCGGGTAACCTCCTCCGTCATATTACTCGAGTAATATGACGGAGGAGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-668s21c1
Sequence:CCGGCAACGTCTTGATGGTTCATAACTCGAGTTATGAACCATCAAGACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-475s21c1
Sequence:CCGGGCGACAGAGATGAGAACATTACTCGAGTAATGTTCTCATCTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011771
IKZF3 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 3 (Aiolos)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-1648s21c1
Sequence:CCGGACGTCCTCTTCCTAGATTATGCTCGAGCATAATCTAGGAAGAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011771.1-3242s21c1
Sequence:CCGGGTGCTTGCCAAGCTCATATTTCTCGAGAAATATGAGCTTGGCAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-754s21c1
Sequence:CCGGGTAACCTCCTCCGTCATATTACTCGAGTAATATGACGGAGGAGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-668s21c1
Sequence:CCGGCAACGTCTTGATGGTTCATAACTCGAGTTATGAACCATCAAGACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011771.1-475s21c1
Sequence:CCGGGCGACAGAGATGAGAACATTACTCGAGTAATGTTCTCATCTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)