EMAIL THIS PAGE TO A FRIEND

IKZF4

IKAROS family zinc finger 4 (Eos)

235 Gene Product Result for
Synonyms: EOS ZNFN1A4
UniProtKB ID: Q9H2S9, Q96JP3
Gene ID:
Human(64375) Summary: Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Eos, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Mouse(22781) IKAROS family zinc finger 4
Rat(100361923) IKAROS family zinc finger 4
domestic guinea pig(100713490) IKAROS family zinc finger 4 (Eos)
sheep(101104142) IKAROS family zinc finger 4 (Eos)
Domestic Rabbit(100342953) IKAROS family zinc finger 4 (Eos)
chicken(101747801) IKAROS family zinc finger 4 (Eos)
cow(540671) IKAROS family zinc finger 4 (Eos)
cow(338405) IKAROS family zinc finger 4 (Eos)
Horse(100051852) IKAROS family zinc finger 4 (Eos)
domestic cat(101094434) IKAROS family zinc finger 4 (Eos)
dog(481104) IKAROS family zinc finger 4 (Eos)
chicken(101669568) IKAROS family zinc finger 4 (Eos)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129851 MISSION® esiRNA esiRNA human IKZF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022465 Rosetta Predictions human pricing
NM_011772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200777 predicted 2293
2 SASI_Hs02_00355736 predicted 2575
3 SASI_Hs01_00200778 predicted 2038
4 SASI_Hs02_00355737 predicted 2499
5 SASI_Hs02_00355738 predicted 1748
6 SASI_Hs01_00200780 predicted 2439
7 SASI_Hs01_00200781 predicted 954
8 SASI_Hs01_00200783 predicted 2405
9 SASI_Hs01_00200784 predicted 1130
10 SASI_Hs01_00200785 predicted 1961
11 SASI_Hs01_00200779 predicted 289
12 SASI_Hs01_00200782 predicted 260
13 SASI_Hs01_00200786 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095441 predicted 2023
2 SASI_Mm02_00321415 predicted 566
3 SASI_Mm01_00095442 predicted 780
4 SASI_Mm01_00095443 predicted 1168
5 SASI_Mm01_00095444 predicted 1077
6 SASI_Mm01_00095445 predicted 1114
7 SASI_Mm01_00095446 predicted 2015
8 SASI_Mm01_00095447 predicted 1163
9 SASI_Mm01_00095448 predicted 2015
10 SASI_Mm01_00095449 predicted 1296
11 SASI_Mm01_00095450 predicted 1803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022465
VALIDATED
IKZF4 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 4 (Eos)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-960s21c1
Sequence:CCGGACAGCGTGATTGTGGAAGATTCTCGAGAATCTTCCACAATCACGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022465.3-657s21c1
Sequence:CCGGACCGGCAAGGGAAGGATAATCCTCGAGGATTATCCTTCCCTTGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-1777s21c1
Sequence:CCGGGCCTGTCATCAGCTCTGTCTACTCGAGTAGACAGAGCTGATGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-2847s21c1
Sequence:CCGGCCTTAGCTCTGTGGCATTATACTCGAGTATAATGCCACAGAGCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1116s1c1
Sequence:CCGGCCCAGAAGTTTGTAGGCGAAACTCGAGTTTCGCCTACAAACTTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022465.2-1321s1c1
Sequence:CCGGGCCTGTCATCAGCTCTGTCTACTCGAGTAGACAGAGCTGATGACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1295s1c1
Sequence:CCGGCCCACCAATTGCATCTCAGAACTCGAGTTCTGAGATGCAATTGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022465.2-504s1c1
Sequence:CCGGACAGCGTGATTGTGGAAGATTCTCGAGAATCTTCCACAATCACGCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1808s1c1
Sequence:CCGGGAGTGCAACATCTGTGGTTATCTCGAGATAACCACAGATGTTGCACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022465
VALIDATED
IKZF4 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 4 (Eos)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-960s21c1
Sequence:CCGGACAGCGTGATTGTGGAAGATTCTCGAGAATCTTCCACAATCACGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022465.3-657s21c1
Sequence:CCGGACCGGCAAGGGAAGGATAATCCTCGAGGATTATCCTTCCCTTGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-1777s21c1
Sequence:CCGGGCCTGTCATCAGCTCTGTCTACTCGAGTAGACAGAGCTGATGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-2847s21c1
Sequence:CCGGCCTTAGCTCTGTGGCATTATACTCGAGTATAATGCCACAGAGCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1116s1c1
Sequence:CCGGCCCAGAAGTTTGTAGGCGAAACTCGAGTTTCGCCTACAAACTTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022465.2-1321s1c1
Sequence:CCGGGCCTGTCATCAGCTCTGTCTACTCGAGTAGACAGAGCTGATGACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1295s1c1
Sequence:CCGGCCCACCAATTGCATCTCAGAACTCGAGTTCTGAGATGCAATTGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022465.2-504s1c1
Sequence:CCGGACAGCGTGATTGTGGAAGATTCTCGAGAATCTTCCACAATCACGCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1808s1c1
Sequence:CCGGGAGTGCAACATCTGTGGTTATCTCGAGATAACCACAGATGTTGCACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022465
VALIDATED
IKZF4 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 4 (Eos)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-960s21c1
Sequence:CCGGACAGCGTGATTGTGGAAGATTCTCGAGAATCTTCCACAATCACGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022465.3-657s21c1
Sequence:CCGGACCGGCAAGGGAAGGATAATCCTCGAGGATTATCCTTCCCTTGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-1777s21c1
Sequence:CCGGGCCTGTCATCAGCTCTGTCTACTCGAGTAGACAGAGCTGATGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_022465.3-2847s21c1
Sequence:CCGGCCTTAGCTCTGTGGCATTATACTCGAGTATAATGCCACAGAGCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1116s1c1
Sequence:CCGGCCCAGAAGTTTGTAGGCGAAACTCGAGTTTCGCCTACAAACTTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022465.2-1321s1c1
Sequence:CCGGGCCTGTCATCAGCTCTGTCTACTCGAGTAGACAGAGCTGATGACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1295s1c1
Sequence:CCGGCCCACCAATTGCATCTCAGAACTCGAGTTCTGAGATGCAATTGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022465.2-504s1c1
Sequence:CCGGACAGCGTGATTGTGGAAGATTCTCGAGAATCTTCCACAATCACGCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022465.2-1808s1c1
Sequence:CCGGGAGTGCAACATCTGTGGTTATCTCGAGATAACCACAGATGTTGCACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011772
IKZF4 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 4 (Eos)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011772.1-2524s1c1
Sequence:CCGGCCCTGACCGATTTGAGCATTTCTCGAGAAATGCTCAAATCGGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1575s1c1
Sequence:CCGGCCACAGAAGTTTGTAGGTGAACTCGAGTTCACCTACAAACTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1520s1c1
Sequence:CCGGGCCAACTTTCATTGATCGTTTCTCGAGAAACGATCAATGAAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-954s1c1
Sequence:CCGGGATAAGGATGACAGTGTGATTCTCGAGAATCACACTGTCATCCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1518s1c1
Sequence:CCGGCGGCCAACTTTCATTGATCGTCTCGAGACGATCAATGAAAGTTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011772
IKZF4 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 4 (Eos)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011772.1-2524s1c1
Sequence:CCGGCCCTGACCGATTTGAGCATTTCTCGAGAAATGCTCAAATCGGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1575s1c1
Sequence:CCGGCCACAGAAGTTTGTAGGTGAACTCGAGTTCACCTACAAACTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1520s1c1
Sequence:CCGGGCCAACTTTCATTGATCGTTTCTCGAGAAACGATCAATGAAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-954s1c1
Sequence:CCGGGATAAGGATGACAGTGTGATTCTCGAGAATCACACTGTCATCCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1518s1c1
Sequence:CCGGCGGCCAACTTTCATTGATCGTCTCGAGACGATCAATGAAAGTTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011772
IKZF4 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 4 (Eos)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011772.1-2524s1c1
Sequence:CCGGCCCTGACCGATTTGAGCATTTCTCGAGAAATGCTCAAATCGGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1575s1c1
Sequence:CCGGCCACAGAAGTTTGTAGGTGAACTCGAGTTCACCTACAAACTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1520s1c1
Sequence:CCGGGCCAACTTTCATTGATCGTTTCTCGAGAAACGATCAATGAAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-954s1c1
Sequence:CCGGGATAAGGATGACAGTGTGATTCTCGAGAATCACACTGTCATCCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011772.1-1518s1c1
Sequence:CCGGCGGCCAACTTTCATTGATCGTCTCGAGACGATCAATGAAAGTTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)