EMAIL THIS PAGE TO A FRIEND

IKZF5

IKAROS family zinc finger 5 (Pegasus)

52 Gene Product Result for
Synonyms: PEGASUS ZNFN1A5
UniProtKB ID: Q9H5V7, B3KVH7, D3DRE7, Q9H2T0
Gene ID:
Human(64376) Summary: Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Pegasus, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Mouse(67143) IKAROS family zinc finger 5
Rat(309031) IKAROS family zinc finger 5
Zebrafish(402893) IKAROS family zinc finger 5
dog(611212) IKAROS family zinc finger 5 (Pegasus)
Horse(100058131) IKAROS family zinc finger 5 (Pegasus)
cow(531250) IKAROS family zinc finger 5 (Pegasus)
domestic cat(101092548) IKAROS family zinc finger 5 (Pegasus)
chicken(430882) IKAROS family zinc finger 5 (Pegasus)
sheep(101113292) IKAROS family zinc finger 5 (Pegasus)
Domestic Rabbit(100351619) IKAROS family zinc finger 5 (Pegasus)
domestic guinea pig(100713154) IKAROS family zinc finger 5 (Pegasus)
naked mole-rat(101699513) IKAROS family zinc finger 5 (Pegasus)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022466 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022466 Rosetta Predictions human pricing
NM_001107555 Rosetta Predictions rat pricing
NM_175115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045732 predicted 629
2 SASI_Hs01_00045733 predicted 915
3 SASI_Hs01_00045735 predicted 975
4 SASI_Hs01_00045736 predicted 520
5 SASI_Hs01_00045737 predicted 858
6 SASI_Hs01_00045738 predicted 760
7 SASI_Hs01_00045739 predicted 794
8 SASI_Hs01_00045740 predicted 715
9 SASI_Hs01_00045741 predicted 674
10 SASI_Hs02_00355739 predicted 648
11 SASI_Hs01_00045734 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229985 predicted 1567
2 SASI_Rn02_00229986 predicted 1579
3 SASI_Rn02_00229987 predicted 1422
4 SASI_Rn02_00229988 predicted 1064
5 SASI_Rn02_00229989 predicted 1634
6 SASI_Rn02_00229990 predicted 877
7 SASI_Rn02_00229991 predicted 1647
8 SASI_Rn02_00229992 predicted 649
9 SASI_Rn02_00229993 predicted 514
10 SASI_Rn02_00229994 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156928 predicted 470
2 SASI_Mm01_00156929 predicted 895
3 SASI_Mm01_00156930 predicted 760
4 SASI_Mm01_00156931 predicted 810
5 SASI_Mm01_00156932 predicted 1462
6 SASI_Mm01_00156933 predicted 1463
7 SASI_Mm01_00156934 predicted 336
8 SASI_Mm01_00156935 predicted 560
9 SASI_Mm02_00345728 predicted 1090
10 SASI_Mm02_00345729 predicted 355
11 SASI_Mm01_00156927 predicted 1323
12 SASI_Mm01_00156936 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175115
VALIDATED
IKZF5 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 5 (Pegasus)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-390s21c1
Sequence:CCGGAGTGTCGGTACTGCAACTATGCTCGAGCATAGTTGCAGTACCGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-720s1c1
Sequence:CCGGGAAGAGCACTAATCAACTTAACTCGAGTTAAGTTGATTAGTGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-1812s1c1
Sequence:CCGGGCCTTTAAGTTTGCTCCTAATCTCGAGATTAGGAGCAAACTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175115.4-208s1c1
Sequence:CCGGGACGCATCATGTGAACATGATCTCGAGATCATGTTCACATGATGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-1323s1c1
Sequence:CCGGGTAACGTATGTGGGTGCAAATCTCGAGATTTGCACCCACATACGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-210s1c1
Sequence:CCGGCGCATCATGTGAACATGATTTCTCGAGAAATCATGTTCACATGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-896s21c1
Sequence:CCGGTTGAATCAGCTCTCTACTTTACTCGAGTAAAGTAGAGAGCTGATTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-307s21c1
Sequence:CCGGTCACCCGTCTGTTGAAGTTTCCTCGAGGAAACTTCAACAGACGGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175115.4-1715s21c1
Sequence:CCGGAGGATATACATTACAGCTAATCTCGAGATTAGCTGTAATGTATATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175115
VALIDATED
IKZF5 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 5 (Pegasus)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-390s21c1
Sequence:CCGGAGTGTCGGTACTGCAACTATGCTCGAGCATAGTTGCAGTACCGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-720s1c1
Sequence:CCGGGAAGAGCACTAATCAACTTAACTCGAGTTAAGTTGATTAGTGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-1812s1c1
Sequence:CCGGGCCTTTAAGTTTGCTCCTAATCTCGAGATTAGGAGCAAACTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175115.4-208s1c1
Sequence:CCGGGACGCATCATGTGAACATGATCTCGAGATCATGTTCACATGATGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-1323s1c1
Sequence:CCGGGTAACGTATGTGGGTGCAAATCTCGAGATTTGCACCCACATACGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-210s1c1
Sequence:CCGGCGCATCATGTGAACATGATTTCTCGAGAAATCATGTTCACATGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-896s21c1
Sequence:CCGGTTGAATCAGCTCTCTACTTTACTCGAGTAAAGTAGAGAGCTGATTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-307s21c1
Sequence:CCGGTCACCCGTCTGTTGAAGTTTCCTCGAGGAAACTTCAACAGACGGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175115.4-1715s21c1
Sequence:CCGGAGGATATACATTACAGCTAATCTCGAGATTAGCTGTAATGTATATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175115
VALIDATED
IKZF5 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 5 (Pegasus)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-390s21c1
Sequence:CCGGAGTGTCGGTACTGCAACTATGCTCGAGCATAGTTGCAGTACCGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-720s1c1
Sequence:CCGGGAAGAGCACTAATCAACTTAACTCGAGTTAAGTTGATTAGTGCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-1812s1c1
Sequence:CCGGGCCTTTAAGTTTGCTCCTAATCTCGAGATTAGGAGCAAACTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175115.4-208s1c1
Sequence:CCGGGACGCATCATGTGAACATGATCTCGAGATCATGTTCACATGATGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-1323s1c1
Sequence:CCGGGTAACGTATGTGGGTGCAAATCTCGAGATTTGCACCCACATACGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175115.4-210s1c1
Sequence:CCGGCGCATCATGTGAACATGATTTCTCGAGAAATCATGTTCACATGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-896s21c1
Sequence:CCGGTTGAATCAGCTCTCTACTTTACTCGAGTAAAGTAGAGAGCTGATTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175115.4-307s21c1
Sequence:CCGGTCACCCGTCTGTTGAAGTTTCCTCGAGGAAACTTCAACAGACGGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175115.4-1715s21c1
Sequence:CCGGAGGATATACATTACAGCTAATCTCGAGATTAGCTGTAATGTATATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022466
VALIDATED
IKZF5 MISSION shRNA Bacterial Glycerol Stock
IKAROS family zinc finger 5 (Pegasus)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022466.5-547s21c1
Sequence:CCGGAGTGTCGGTACTGCAACTATGCTCGAGCATAGTTGCAGTACCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-1029s21c1
Sequence:GTACCGGCAAGAACTCATGGTTGATAACCTCGAGGTTATCAACCATGAGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-1262s1c1
Sequence:CCGGCCCATAGTCAAAGGAACTATACTCGAGTATAGTTCCTTTGACTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-523s1c1
Sequence:CCGGGACGGGTTTGAAAGGACCTTTCTCGAGAAAGGTCCTTTCAAACCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-661s1c1
Sequence:CCGGGCATCTGCTTATGAGCGTCATCTCGAGATGACGCTCATAAGCAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022466.2-757s1c1
Sequence:CCGGCGAAGTAACTTGTCCCATCATCTCGAGATGATGGGACAAGTTACTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022466.2-984s1c1
Sequence:CCGGCTCCTATGAAAGTATGGCAAACTCGAGTTTGCCATACTTTCATAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-870s21c1
Sequence:CCGGTATAGCAGAAGAGCACTAATCCTCGAGGATTAGTGCTCTTCTGCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-380s21c1
Sequence:GTACCGGCATGATTTCTGGATCAGTTAGCTCGAGCTAACTGATCCAGAAATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-1244s21c1
Sequence:CCGGTCGGCCATCCCATAGTCAAAGCTCGAGCTTTGACTATGGGATGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022466
VALIDATED
IKZF5 MISSION shRNA shRNA Plasmid DNA
IKAROS family zinc finger 5 (Pegasus)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022466.5-547s21c1
Sequence:CCGGAGTGTCGGTACTGCAACTATGCTCGAGCATAGTTGCAGTACCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-1029s21c1
Sequence:GTACCGGCAAGAACTCATGGTTGATAACCTCGAGGTTATCAACCATGAGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-1262s1c1
Sequence:CCGGCCCATAGTCAAAGGAACTATACTCGAGTATAGTTCCTTTGACTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-523s1c1
Sequence:CCGGGACGGGTTTGAAAGGACCTTTCTCGAGAAAGGTCCTTTCAAACCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-661s1c1
Sequence:CCGGGCATCTGCTTATGAGCGTCATCTCGAGATGACGCTCATAAGCAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022466.2-757s1c1
Sequence:CCGGCGAAGTAACTTGTCCCATCATCTCGAGATGATGGGACAAGTTACTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022466.2-984s1c1
Sequence:CCGGCTCCTATGAAAGTATGGCAAACTCGAGTTTGCCATACTTTCATAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-870s21c1
Sequence:CCGGTATAGCAGAAGAGCACTAATCCTCGAGGATTAGTGCTCTTCTGCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-380s21c1
Sequence:GTACCGGCATGATTTCTGGATCAGTTAGCTCGAGCTAACTGATCCAGAAATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-1244s21c1
Sequence:CCGGTCGGCCATCCCATAGTCAAAGCTCGAGCTTTGACTATGGGATGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022466
VALIDATED
IKZF5 MISSION shRNA Lentiviral Transduction Particles
IKAROS family zinc finger 5 (Pegasus)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022466.5-547s21c1
Sequence:CCGGAGTGTCGGTACTGCAACTATGCTCGAGCATAGTTGCAGTACCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-1029s21c1
Sequence:GTACCGGCAAGAACTCATGGTTGATAACCTCGAGGTTATCAACCATGAGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-1262s1c1
Sequence:CCGGCCCATAGTCAAAGGAACTATACTCGAGTATAGTTCCTTTGACTATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-523s1c1
Sequence:CCGGGACGGGTTTGAAAGGACCTTTCTCGAGAAAGGTCCTTTCAAACCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_022466.2-661s1c1
Sequence:CCGGGCATCTGCTTATGAGCGTCATCTCGAGATGACGCTCATAAGCAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022466.2-757s1c1
Sequence:CCGGCGAAGTAACTTGTCCCATCATCTCGAGATGATGGGACAAGTTACTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022466.2-984s1c1
Sequence:CCGGCTCCTATGAAAGTATGGCAAACTCGAGTTTGCCATACTTTCATAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-870s21c1
Sequence:CCGGTATAGCAGAAGAGCACTAATCCTCGAGGATTAGTGCTCTTCTGCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-380s21c1
Sequence:GTACCGGCATGATTTCTGGATCAGTTAGCTCGAGCTAACTGATCCAGAAATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022466.5-1244s21c1
Sequence:CCGGTCGGCCATCCCATAGTCAAAGCTCGAGCTTTGACTATGGGATGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)