EMAIL THIS PAGE TO A FRIEND

IL10

interleukin 10

146 Gene Product Result for
Synonyms: CSIF GVHDS IL-10 IL10A TGIF
UniProtKB ID: P22301
Gene ID:
Human(3586) Summary: The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. Mutations in this gene are associated with an increased susceptibility to HIV-1 infection and rheumatoid arthritis.[provided by RefSeq, May 2011]
Mouse(16153) interleukin 10
Rat(25325) interleukin 10
Goat(100860746) interleukin 10
sheep(443342) interleukin 10
naked mole-rat(101708273) interleukin 10
Zebrafish(553957) interleukin 10
chicken(428264) interleukin 10
dog(403628) interleukin 10
cow(281246) interleukin 10
Horse(100034187) interleukin 10
domestic cat(493683) interleukin 10
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000572 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145171 MISSION® esiRNA esiRNA human IL10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000572 Rosetta Predictions human pricing
NM_012854 Rosetta Predictions rat pricing
NM_010548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060266 predicted 521
2 SASI_Hs01_00060268 predicted 296
3 SASI_Hs01_00060269 predicted 223
4 SASI_Hs02_00302816 predicted 205
5 SASI_Hs01_00060271 predicted 361
6 SASI_Hs01_00060272 predicted 555
7 SASI_Hs02_00302817 predicted 529
8 SASI_Hs02_00302818 predicted 294
9 SASI_Hs02_00302819 predicted 497
10 SASI_Hs02_00302820 predicted 284
11 SASI_Hs01_00060264 predicted 481
12 SASI_Hs01_00060265 predicted 205
13 SASI_Hs01_00060267 predicted 538
14 SASI_Hs01_00060270 predicted 563
15 SASI_Hs01_00060273 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260329 predicted 360
2 SASI_Rn01_00031466 predicted 303
3 SASI_Rn01_00031467 predicted 449
4 SASI_Rn02_00260330 predicted 415
5 SASI_Rn02_00260331 predicted 300
6 SASI_Rn02_00260332 predicted 229
7 SASI_Rn02_00260333 predicted 339
8 SASI_Rn02_00260334 predicted 290
9 SASI_Rn02_00260335 predicted 369
10 SASI_Rn02_00260336 predicted 438
11 SASI_Rn01_00031468 predicted 511
12 SASI_Rn01_00031469 predicted 721
13 SASI_Rn01_00031470 predicted 871
14 SASI_Rn01_00031471 predicted 723
15 SASI_Rn01_00031472 predicted 927
16 SASI_Rn01_00031473 predicted 864
17 SASI_Rn01_00031474 predicted 1030
18 SASI_Rn01_00031475 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111531 predicted 376
2 SASI_Mm01_00111532 predicted 539
3 SASI_Mm01_00111533 predicted 681
4 SASI_Mm01_00111534 predicted 767
5 SASI_Mm01_00111535 predicted 573
6 SASI_Mm01_00111536 predicted 853
7 SASI_Mm01_00111537 predicted 935
8 SASI_Mm01_00111538 predicted 986
9 SASI_Mm01_00111539 predicted 1036
10 SASI_Mm02_00318805 predicted 710
11 SASI_Mm01_00111530 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000572
IL10 MISSION shRNA Bacterial Glycerol Stock
interleukin 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000572.2-857s21c1
Sequence:CCGGGGGTGACACACTATGGTATTTCTCGAGAAATACCATAGTGTGTCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000572.2-426s21c1
Sequence:CCGGCTACGGCGCTGTCATCGATTTCTCGAGAAATCGATGACAGCGCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000572.2-767s21c1
Sequence:CCGGAGCTTCTCTGTGAACGATTTACTCGAGTAAATCGTTCACAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-299s1c1
Sequence:CCGGCCAAGCCTTGTCTGAGATGATCTCGAGATCATCTCAGACAAGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-479s1c1
Sequence:CCGGGCAGGTGAAGAATGCCTTTAACTCGAGTTAAAGGCATTCTTCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-567s1c1
Sequence:CCGGGCCTACATGACAATGAAGATACTCGAGTATCTTCATTGTCATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-168s1c1
Sequence:CCGGCTGCCTAACATGCTTCGAGATCTCGAGATCTCGAAGCATGTTAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-239s1c1
Sequence:CCGGGCTGGACAACTTGTTGTTAAACTCGAGTTTAACAACAAGTTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000572
IL10 MISSION shRNA shRNA Plasmid DNA
interleukin 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000572.2-857s21c1
Sequence:CCGGGGGTGACACACTATGGTATTTCTCGAGAAATACCATAGTGTGTCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000572.2-426s21c1
Sequence:CCGGCTACGGCGCTGTCATCGATTTCTCGAGAAATCGATGACAGCGCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000572.2-767s21c1
Sequence:CCGGAGCTTCTCTGTGAACGATTTACTCGAGTAAATCGTTCACAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-299s1c1
Sequence:CCGGCCAAGCCTTGTCTGAGATGATCTCGAGATCATCTCAGACAAGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-479s1c1
Sequence:CCGGGCAGGTGAAGAATGCCTTTAACTCGAGTTAAAGGCATTCTTCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-567s1c1
Sequence:CCGGGCCTACATGACAATGAAGATACTCGAGTATCTTCATTGTCATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-168s1c1
Sequence:CCGGCTGCCTAACATGCTTCGAGATCTCGAGATCTCGAAGCATGTTAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-239s1c1
Sequence:CCGGGCTGGACAACTTGTTGTTAAACTCGAGTTTAACAACAAGTTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000572
IL10 MISSION shRNA Lentiviral Transduction Particles
interleukin 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000572.2-857s21c1
Sequence:CCGGGGGTGACACACTATGGTATTTCTCGAGAAATACCATAGTGTGTCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000572.2-426s21c1
Sequence:CCGGCTACGGCGCTGTCATCGATTTCTCGAGAAATCGATGACAGCGCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000572.2-767s21c1
Sequence:CCGGAGCTTCTCTGTGAACGATTTACTCGAGTAAATCGTTCACAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-299s1c1
Sequence:CCGGCCAAGCCTTGTCTGAGATGATCTCGAGATCATCTCAGACAAGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-479s1c1
Sequence:CCGGGCAGGTGAAGAATGCCTTTAACTCGAGTTAAAGGCATTCTTCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-567s1c1
Sequence:CCGGGCCTACATGACAATGAAGATACTCGAGTATCTTCATTGTCATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-168s1c1
Sequence:CCGGCTGCCTAACATGCTTCGAGATCTCGAGATCTCGAAGCATGTTAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000572.2-239s1c1
Sequence:CCGGGCTGGACAACTTGTTGTTAAACTCGAGTTTAACAACAAGTTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010548
IL10 MISSION shRNA Bacterial Glycerol Stock
interleukin 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010548.1-989s1c1
Sequence:CCGGCCCTTTGCTATGGTGTCCTTTCTCGAGAAAGGACACCATAGCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-381s1c1
Sequence:CCGGCCCAGAAATCAAGGAGCATTTCTCGAGAAATGCTCCTTGATTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-315s1c1
Sequence:CCGGCCAAGCCTTATCGGAAATGATCTCGAGATCATTTCCGATAAGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-288s1c1
Sequence:CCGGGCAGGACTTTAAGGGTTACTTCTCGAGAAGTAACCCTTAAAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-276s1c1
Sequence:CCGGCGACTCCTTAATGCAGGACTTCTCGAGAAGTCCTGCATTAAGGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010548
IL10 MISSION shRNA shRNA Plasmid DNA
interleukin 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010548.1-989s1c1
Sequence:CCGGCCCTTTGCTATGGTGTCCTTTCTCGAGAAAGGACACCATAGCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-381s1c1
Sequence:CCGGCCCAGAAATCAAGGAGCATTTCTCGAGAAATGCTCCTTGATTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-315s1c1
Sequence:CCGGCCAAGCCTTATCGGAAATGATCTCGAGATCATTTCCGATAAGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-288s1c1
Sequence:CCGGGCAGGACTTTAAGGGTTACTTCTCGAGAAGTAACCCTTAAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-276s1c1
Sequence:CCGGCGACTCCTTAATGCAGGACTTCTCGAGAAGTCCTGCATTAAGGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010548
IL10 MISSION shRNA Lentiviral Transduction Particles
interleukin 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010548.1-989s1c1
Sequence:CCGGCCCTTTGCTATGGTGTCCTTTCTCGAGAAAGGACACCATAGCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-381s1c1
Sequence:CCGGCCCAGAAATCAAGGAGCATTTCTCGAGAAATGCTCCTTGATTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-315s1c1
Sequence:CCGGCCAAGCCTTATCGGAAATGATCTCGAGATCATTTCCGATAAGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-288s1c1
Sequence:CCGGGCAGGACTTTAAGGGTTACTTCTCGAGAAGTAACCCTTAAAGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010548.1-276s1c1
Sequence:CCGGCGACTCCTTAATGCAGGACTTCTCGAGAAGTCCTGCATTAAGGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)