EMAIL THIS PAGE TO A FRIEND

IL10RA

interleukin 10 receptor, alpha

82 Gene Product Result for
Synonyms: CD210 CD210a CDW210A HIL-10R IL-10R1 IL10R
UniProtKB ID: Q13651, A8K6I0, B0YJ27
Gene ID:
Human(3587) Summary: The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(16154) interleukin 10 receptor, alpha
Rat(117539) interleukin 10 receptor, alpha
Zebrafish(777651) interleukin 10 receptor, alpha
chicken(419771) interleukin 10 receptor, alpha
dog(610823) interleukin 10 receptor, alpha
cow(513478) interleukin 10 receptor, alpha
domestic cat(101087601) interleukin 10 receptor, alpha
domestic guinea pig(100727507) interleukin 10 receptor, alpha
naked mole-rat(101706532) interleukin 10 receptor, alpha
sheep(101120946) interleukin 10 receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001558 Rosetta Predictions human pricing
NM_057193 Rosetta Predictions rat pricing
NM_008348 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079439 predicted 956
2 SASI_Hs01_00079440 predicted 451
3 SASI_Hs01_00079441 predicted 524
4 SASI_Hs01_00079442 predicted 1463
5 SASI_Hs01_00079443 predicted 842
6 SASI_Hs01_00079444 predicted 308
7 SASI_Hs01_00079445 predicted 209
8 SASI_Hs01_00079446 predicted 221
9 SASI_Hs02_00332128 predicted 549
10 SASI_Hs01_00079447 predicted 233
11 SASI_Hs01_00079448 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048915 predicted 1415
2 SASI_Rn01_00048916 predicted 719
3 SASI_Rn01_00048917 predicted 391
4 SASI_Rn01_00048918 predicted 658
5 SASI_Rn02_00267144 predicted 450
6 SASI_Rn01_00048919 predicted 674
7 SASI_Rn01_00048920 predicted 493
8 SASI_Rn01_00048921 predicted 1396
9 SASI_Rn01_00048922 predicted 554
10 SASI_Rn01_00048923 predicted 265
11 SASI_Rn01_00048914 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097317 predicted 1265
2 SASI_Mm01_00097318 predicted 1679
3 SASI_Mm01_00097319 predicted 1604
4 SASI_Mm01_00097320 predicted 1663
5 SASI_Mm02_00313685 predicted 1437
6 SASI_Mm02_00313686 predicted 476
7 SASI_Mm01_00097322 predicted 1652
8 SASI_Mm01_00097323 predicted 309
9 SASI_Mm02_00313687 predicted 1541
10 SASI_Mm01_00097324 predicted 232
11 SASI_Mm01_00097321 predicted 888
12 SASI_Mm01_00097325 predicted 1054
13 SASI_Mm01_00097326 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008348
IL10RA MISSION shRNA Bacterial Glycerol Stock
interleukin 10 receptor, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-580s1c1
Sequence:CCGGCCGAGTTTACAAGATTTCCATCTCGAGATGGAAATCTTGTAAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-1472s1c1
Sequence:CCGGCCCTTGACAGATGCCTTTGATCTCGAGATCAAAGGCATCTGTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-208s1c1
Sequence:CCGGCCACTGGAAACCTATCCCAAACTCGAGTTTGGGATAGGTTTCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-1404s1c1
Sequence:CCGGGCTACCAGAAACAGACCAGATCTCGAGATCTGGTCTGTTTCTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-706s1c1
Sequence:CCGGCCGCTTGGAATCCCGAATTAACTCGAGTTAATTCGGGATTCCAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008348
IL10RA MISSION shRNA shRNA Plasmid DNA
interleukin 10 receptor, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-580s1c1
Sequence:CCGGCCGAGTTTACAAGATTTCCATCTCGAGATGGAAATCTTGTAAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-1472s1c1
Sequence:CCGGCCCTTGACAGATGCCTTTGATCTCGAGATCAAAGGCATCTGTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-208s1c1
Sequence:CCGGCCACTGGAAACCTATCCCAAACTCGAGTTTGGGATAGGTTTCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-1404s1c1
Sequence:CCGGGCTACCAGAAACAGACCAGATCTCGAGATCTGGTCTGTTTCTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-706s1c1
Sequence:CCGGCCGCTTGGAATCCCGAATTAACTCGAGTTAATTCGGGATTCCAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008348
IL10RA MISSION shRNA Lentiviral Transduction Particles
interleukin 10 receptor, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-580s1c1
Sequence:CCGGCCGAGTTTACAAGATTTCCATCTCGAGATGGAAATCTTGTAAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-1472s1c1
Sequence:CCGGCCCTTGACAGATGCCTTTGATCTCGAGATCAAAGGCATCTGTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-208s1c1
Sequence:CCGGCCACTGGAAACCTATCCCAAACTCGAGTTTGGGATAGGTTTCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-1404s1c1
Sequence:CCGGGCTACCAGAAACAGACCAGATCTCGAGATCTGGTCTGTTTCTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008348.1-706s1c1
Sequence:CCGGCCGCTTGGAATCCCGAATTAACTCGAGTTAATTCGGGATTCCAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001558
IL10RA MISSION shRNA Bacterial Glycerol Stock
interleukin 10 receptor, alpha
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-758s1c1
Sequence:CCGGGCAGTATTTCACCGTGACCAACTCGAGTTGGTCACGGTGAAATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-1275s1c1
Sequence:CCGGAGTGGCATTGACTTAGTTCAACTCGAGTTGAACTAAGTCAATGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-528s1c1
Sequence:CCGGCCCGCAAATGACACATATGAACTCGAGTTCATATGTGTCATTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001558.3-2105s21c1
Sequence:CCGGGAACTCTTTCCTGTATCATAACTCGAGTTATGATACAGGAAAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001558.3-699s21c1
Sequence:CCGGTCTGTCGCTTCCCGAAGTAACCTCGAGGTTACTTCGGGAAGCGACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001558.3-1568s21c1
Sequence:CCGGGAAACAGGATCCTCTAGAAATCTCGAGATTTCTAGAGGATCCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001558
IL10RA MISSION shRNA shRNA Plasmid DNA
interleukin 10 receptor, alpha
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-758s1c1
Sequence:CCGGGCAGTATTTCACCGTGACCAACTCGAGTTGGTCACGGTGAAATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-1275s1c1
Sequence:CCGGAGTGGCATTGACTTAGTTCAACTCGAGTTGAACTAAGTCAATGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-528s1c1
Sequence:CCGGCCCGCAAATGACACATATGAACTCGAGTTCATATGTGTCATTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001558.3-2105s21c1
Sequence:CCGGGAACTCTTTCCTGTATCATAACTCGAGTTATGATACAGGAAAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001558.3-699s21c1
Sequence:CCGGTCTGTCGCTTCCCGAAGTAACCTCGAGGTTACTTCGGGAAGCGACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001558.3-1568s21c1
Sequence:CCGGGAAACAGGATCCTCTAGAAATCTCGAGATTTCTAGAGGATCCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001558
IL10RA MISSION shRNA Lentiviral Transduction Particles
interleukin 10 receptor, alpha
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-758s1c1
Sequence:CCGGGCAGTATTTCACCGTGACCAACTCGAGTTGGTCACGGTGAAATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-1275s1c1
Sequence:CCGGAGTGGCATTGACTTAGTTCAACTCGAGTTGAACTAAGTCAATGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001558.2-528s1c1
Sequence:CCGGCCCGCAAATGACACATATGAACTCGAGTTCATATGTGTCATTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001558.3-2105s21c1
Sequence:CCGGGAACTCTTTCCTGTATCATAACTCGAGTTATGATACAGGAAAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001558.3-699s21c1
Sequence:CCGGTCTGTCGCTTCCCGAAGTAACCTCGAGGTTACTTCGGGAAGCGACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001558.3-1568s21c1
Sequence:CCGGGAAACAGGATCCTCTAGAAATCTCGAGATTTCTAGAGGATCCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)