EMAIL THIS PAGE TO A FRIEND

IL10RB

interleukin 10 receptor, beta

68 Gene Product Result for
Synonyms: CDW210B CRF2-4 CRFB4 D21S58 D21S66 IL-10R2
UniProtKB ID: Q08334, Q9BUU4
Gene ID:
Human(3588) Summary: The protein encoded by this gene belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. This gene and three other interferon receptor genes, IFAR2, IFNAR1, and IFNGR2, form a class II cytokine receptor gene cluster located in a small region on chromosome 21. [provided by RefSeq, Jul 2008]
Mouse(16155) interleukin 10 receptor, beta
Rat(304091) interleukin 10 receptor, beta
Domestic Rabbit(100328809) interleukin 10 receptor, beta
domestic guinea pig(100716064) interleukin 10 receptor, beta
naked mole-rat(101723546) interleukin 10 receptor, beta
chicken(395663) interleukin 10 receptor, beta
domestic cat(101090038) interleukin 10 receptor, beta
dog(478404) interleukin 10 receptor, beta
cow(767864) interleukin 10 receptor, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000628 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000051 MISSION® esiRNA esiRNA targeting human IL10RB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000628 Rosetta Predictions human pricing
NM_001107111 Rosetta Predictions rat pricing
NM_008349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070903 predicted 642
2 SASI_Hs01_00070904 predicted 380
3 SASI_Hs01_00070905 predicted 545
4 SASI_Hs01_00070906 predicted 659
5 SASI_Hs01_00070907 predicted 536
6 SASI_Hs01_00070908 predicted 719
7 SASI_Hs01_00070909 predicted 306
8 SASI_Hs01_00070910 predicted 618
9 SASI_Hs01_00070911 predicted 526
10 SASI_Hs01_00070912 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225606 predicted 606
2 SASI_Rn02_00225607 predicted 264
3 SASI_Rn02_00225608 predicted 523
4 SASI_Rn02_00225609 predicted 804
5 SASI_Rn02_00225610 predicted 721
6 SASI_Rn02_00225611 predicted 1185
7 SASI_Rn02_00225612 predicted 591
8 SASI_Rn02_00225613 predicted 544
9 SASI_Rn02_00225614 predicted 592
10 SASI_Rn02_00225615 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056625 predicted 642
2 SASI_Mm02_00313688 predicted 252
3 SASI_Mm01_00056627 predicted 569
4 SASI_Mm02_00313689 predicted 231
5 SASI_Mm01_00056628 predicted 1232
6 SASI_Mm02_00313690 predicted 355
7 SASI_Mm01_00056630 predicted 1193
8 SASI_Mm02_00313691 predicted 588
9 SASI_Mm01_00056632 predicted 571
10 SASI_Mm01_00056634 predicted 844
11 SASI_Mm01_00056626 predicted 1157
12 SASI_Mm01_00056629 predicted 1143
13 SASI_Mm01_00056631 predicted 565
14 SASI_Mm01_00056633 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008349
VALIDATED
IL10RB MISSION shRNA Bacterial Glycerol Stock
interleukin 10 receptor, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-955s21c1
Sequence:CCGGCCGAGGTGTTCGACAAACTAACTCGAGTTAGTTTGTCGAACACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-636s21c1
Sequence:CCGGCCGTGGACAACTTACTGCATTCTCGAGAATGCAGTAAGTTGTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008349.5-1233s21c1
Sequence:CCGGGGGAATTTGCTGCCATATAAACTCGAGTTTATATGGCAGCAAATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-236s21c1
Sequence:CCGGCCTGACTTTCACAGCTCAGTACTCGAGTACTGAGCTGTGAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-159s21c1
Sequence:CCGGCCTGAGAAGGTCAGAATGAATCTCGAGATTCATTCTGACCTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-72s1c1
Sequence:CCGGCCTGAGAAGGTCAGAATGAATCTCGAGATTCATTCTGACCTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008349.1-321s1c1
Sequence:CCGGCCCGTGGAAGACACCATCATTCTCGAGAATGATGGTGTCTTCCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-149s1c1
Sequence:CCGGCCTGACTTTCACAGCTCAGTACTCGAGTACTGAGCTGTGAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008349.1-549s1c1
Sequence:CCGGCCGTGGACAACTTACTGCATTCTCGAGAATGCAGTAAGTTGTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-868s1c1
Sequence:CCGGCCGAGGTGTTCGACAAACTAACTCGAGTTAGTTTGTCGAACACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008349
VALIDATED
IL10RB MISSION shRNA shRNA Plasmid DNA
interleukin 10 receptor, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-955s21c1
Sequence:CCGGCCGAGGTGTTCGACAAACTAACTCGAGTTAGTTTGTCGAACACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-636s21c1
Sequence:CCGGCCGTGGACAACTTACTGCATTCTCGAGAATGCAGTAAGTTGTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008349.5-1233s21c1
Sequence:CCGGGGGAATTTGCTGCCATATAAACTCGAGTTTATATGGCAGCAAATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-236s21c1
Sequence:CCGGCCTGACTTTCACAGCTCAGTACTCGAGTACTGAGCTGTGAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-159s21c1
Sequence:CCGGCCTGAGAAGGTCAGAATGAATCTCGAGATTCATTCTGACCTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-72s1c1
Sequence:CCGGCCTGAGAAGGTCAGAATGAATCTCGAGATTCATTCTGACCTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008349.1-321s1c1
Sequence:CCGGCCCGTGGAAGACACCATCATTCTCGAGAATGATGGTGTCTTCCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-149s1c1
Sequence:CCGGCCTGACTTTCACAGCTCAGTACTCGAGTACTGAGCTGTGAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008349.1-549s1c1
Sequence:CCGGCCGTGGACAACTTACTGCATTCTCGAGAATGCAGTAAGTTGTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-868s1c1
Sequence:CCGGCCGAGGTGTTCGACAAACTAACTCGAGTTAGTTTGTCGAACACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008349
VALIDATED
IL10RB MISSION shRNA Lentiviral Transduction Particles
interleukin 10 receptor, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-955s21c1
Sequence:CCGGCCGAGGTGTTCGACAAACTAACTCGAGTTAGTTTGTCGAACACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-636s21c1
Sequence:CCGGCCGTGGACAACTTACTGCATTCTCGAGAATGCAGTAAGTTGTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008349.5-1233s21c1
Sequence:CCGGGGGAATTTGCTGCCATATAAACTCGAGTTTATATGGCAGCAAATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-236s21c1
Sequence:CCGGCCTGACTTTCACAGCTCAGTACTCGAGTACTGAGCTGTGAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008349.5-159s21c1
Sequence:CCGGCCTGAGAAGGTCAGAATGAATCTCGAGATTCATTCTGACCTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-72s1c1
Sequence:CCGGCCTGAGAAGGTCAGAATGAATCTCGAGATTCATTCTGACCTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008349.1-321s1c1
Sequence:CCGGCCCGTGGAAGACACCATCATTCTCGAGAATGATGGTGTCTTCCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-149s1c1
Sequence:CCGGCCTGACTTTCACAGCTCAGTACTCGAGTACTGAGCTGTGAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008349.1-549s1c1
Sequence:CCGGCCGTGGACAACTTACTGCATTCTCGAGAATGCAGTAAGTTGTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008349.1-868s1c1
Sequence:CCGGCCGAGGTGTTCGACAAACTAACTCGAGTTAGTTTGTCGAACACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000628
VALIDATED
IL10RB MISSION shRNA Bacterial Glycerol Stock
interleukin 10 receptor, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-265s21c1
Sequence:CCGGTACCTAAGTTATAGGATATTCCTCGAGGAATATCCTATAACTTAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-837s21c1
Sequence:CCGGGTGCGTTTACAAGAAGACAAACTCGAGTTTGTCTTCTTGTAAACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-387s21c1
Sequence:CCGGGCATTCAGACTGGGTAAACATCTCGAGATGTTTACCCAGTCTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-418s21c1
Sequence:CCGGCCTGTGGATGACACCATTATTCTCGAGAATAATGGTGTCATCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-1315s21c1
Sequence:CCGGTGGCCACTGAGAGTGTAATTTCTCGAGAAATTACACTCTCAGTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-418s1c1
Sequence:CCGGCCTGTGGATGACACCATTATTCTCGAGAATAATGGTGTCATCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-945s1c1
Sequence:CCGGCTTTCCATTGTCGGATGAGAACTCGAGTTCTCATCCGACAATGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-387s1c1
Sequence:CCGGGCATTCAGACTGGGTAAACATCTCGAGATGTTTACCCAGTCTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-837s1c1
Sequence:CCGGGTGCGTTTACAAGAAGACAAACTCGAGTTTGTCTTCTTGTAAACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000628.3-519s1c1
Sequence:CCGGCGAAACTTGGACTATGAAGAACTCGAGTTCTTCATAGTCCAAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000628
VALIDATED
IL10RB MISSION shRNA shRNA Plasmid DNA
interleukin 10 receptor, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-265s21c1
Sequence:CCGGTACCTAAGTTATAGGATATTCCTCGAGGAATATCCTATAACTTAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-837s21c1
Sequence:CCGGGTGCGTTTACAAGAAGACAAACTCGAGTTTGTCTTCTTGTAAACGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-387s21c1
Sequence:CCGGGCATTCAGACTGGGTAAACATCTCGAGATGTTTACCCAGTCTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-418s21c1
Sequence:CCGGCCTGTGGATGACACCATTATTCTCGAGAATAATGGTGTCATCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-1315s21c1
Sequence:CCGGTGGCCACTGAGAGTGTAATTTCTCGAGAAATTACACTCTCAGTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-418s1c1
Sequence:CCGGCCTGTGGATGACACCATTATTCTCGAGAATAATGGTGTCATCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-945s1c1
Sequence:CCGGCTTTCCATTGTCGGATGAGAACTCGAGTTCTCATCCGACAATGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-387s1c1
Sequence:CCGGGCATTCAGACTGGGTAAACATCTCGAGATGTTTACCCAGTCTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-837s1c1
Sequence:CCGGGTGCGTTTACAAGAAGACAAACTCGAGTTTGTCTTCTTGTAAACGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000628.3-519s1c1
Sequence:CCGGCGAAACTTGGACTATGAAGAACTCGAGTTCTTCATAGTCCAAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000628
VALIDATED
IL10RB MISSION shRNA Lentiviral Transduction Particles
interleukin 10 receptor, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-265s21c1
Sequence:CCGGTACCTAAGTTATAGGATATTCCTCGAGGAATATCCTATAACTTAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-837s21c1
Sequence:CCGGGTGCGTTTACAAGAAGACAAACTCGAGTTTGTCTTCTTGTAAACGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-387s21c1
Sequence:CCGGGCATTCAGACTGGGTAAACATCTCGAGATGTTTACCCAGTCTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-418s21c1
Sequence:CCGGCCTGTGGATGACACCATTATTCTCGAGAATAATGGTGTCATCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000628.3-1315s21c1
Sequence:CCGGTGGCCACTGAGAGTGTAATTTCTCGAGAAATTACACTCTCAGTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-418s1c1
Sequence:CCGGCCTGTGGATGACACCATTATTCTCGAGAATAATGGTGTCATCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-945s1c1
Sequence:CCGGCTTTCCATTGTCGGATGAGAACTCGAGTTCTCATCCGACAATGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-387s1c1
Sequence:CCGGGCATTCAGACTGGGTAAACATCTCGAGATGTTTACCCAGTCTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000628.3-837s1c1
Sequence:CCGGGTGCGTTTACAAGAAGACAAACTCGAGTTTGTCTTCTTGTAAACGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000628.3-519s1c1
Sequence:CCGGCGAAACTTGGACTATGAAGAACTCGAGTTCTTCATAGTCCAAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)