EMAIL THIS PAGE TO A FRIEND

IL11

interleukin 11

91 Gene Product Result for
Synonyms: AGIF IL-11
UniProtKB ID: P20809, B4DQV5, Q96EB4
Gene ID:
Human(3589) Summary: The protein encoded by this gene is a member of the gp130 family of cytokines. These cytokines drive the assembly of multisubunit receptor complexes, all of which contain at least one molecule of the transmembrane signaling receptor IL6ST (gp130). This cytokine is shown to stimulate the T-cell-dependent development of immunoglobulin-producing B cells. It is also found to support the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(16156) interleukin 11
Rat(171040) interleukin 11
dog(611309) interleukin 11
domestic cat(101085086) interleukin 11
cow(100337295) interleukin 11
naked mole-rat(101706608) interleukin 11
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000641 Rosetta Predictions human pricing
NM_133519 Rosetta Predictions rat pricing
NM_008350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016796 predicted 1129
2 SASI_Hs01_00016797 predicted 887
3 SASI_Hs01_00016798 predicted 1125
4 SASI_Hs01_00016799 predicted 1151
5 SASI_Hs01_00016800 predicted 1147
6 SASI_Hs01_00016801 predicted 971
7 SASI_Hs01_00016803 predicted 1156
8 SASI_Hs02_00302997 predicted 878
9 SASI_Hs01_00016804 predicted 300
10 SASI_Hs01_00016805 predicted 882
11 SASI_Hs01_00016802 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097171 predicted 745
2 SASI_Rn01_00097172 predicted 897
3 SASI_Rn01_00097173 predicted 721
4 SASI_Rn01_00097174 predicted 309
5 SASI_Rn01_00097175 predicted 733
6 SASI_Rn01_00097176 predicted 542
7 SASI_Rn01_00097177 predicted 285
8 SASI_Rn01_00097178 predicted 1002
9 SASI_Rn01_00097179 predicted 400
10 SASI_Rn01_00097180 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313692 predicted 811
2 SASI_Mm02_00313693 predicted 334
3 SASI_Mm02_00313694 predicted 229
4 SASI_Mm02_00313695 predicted 199
5 SASI_Mm02_00313696 predicted 455
6 SASI_Mm02_00313697 predicted 449
7 SASI_Mm02_00313698 predicted 868
8 SASI_Mm02_00313699 predicted 341
9 SASI_Mm02_00313700 predicted 315
10 SASI_Mm02_00313701 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008350
IL11 MISSION shRNA Bacterial Glycerol Stock
interleukin 11
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-291s1c1
Sequence:CCGGCGCTGGGACATTGGGATCTTTCTCGAGAAAGATCCCAATGTCCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-214s21c1
Sequence:CCGGCTGCACAGATGAGAGACAAATCTCGAGATTTGTCTCTCATCTGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008350.1-818s1c1
Sequence:CCGGCCTGTGGCTTATTTATACTTACTCGAGTAAGTATAAATAAGCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-624s1c1
Sequence:CCGGGCTGTTGTTAAAGACTCGACTCTCGAGAGTCGAGTCTTTAACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-217s1c1
Sequence:CCGGGCTGCACAGATGAGAGACAAACTCGAGTTTGTCTCTCATCTGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-459s1c1
Sequence:CCGGCCGCCGTTTACAGCTCTTGATCTCGAGATCAAGAGCTGTAAACGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.3-266s21c1
Sequence:CCGGAGATCTGGACAGCGCTGTTCTCTCGAGAGAACAGCGCTGTCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-288s21c1
Sequence:CCGGGCTGGGACATTGGGATCTTTGCTCGAGCAAAGATCCCAATGTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.3-326s21c1
Sequence:CCGGTGCACAGATGAGAGACAAATTCTCGAGAATTTGTCTCTCATCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008350.3-918s21c1
Sequence:CCGGGGGATCACCTGTGGCTTATTTCTCGAGAAATAAGCCACAGGTGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008350.2-662s21c1
Sequence:CCGGCCATCGATACCGCCCTTTAAACTCGAGTTTAAAGGGCGGTATCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-323s21c1
Sequence:CCGGGCTGACAAGGCTTCGAGTAGACTCGAGTCTACTCGAAGCCTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-353s21c1
Sequence:CCGGCTACCTCCGGCATGTACAATGCTCGAGCATTGTACATGCCGGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008350
IL11 MISSION shRNA shRNA Plasmid DNA
interleukin 11
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-291s1c1
Sequence:CCGGCGCTGGGACATTGGGATCTTTCTCGAGAAAGATCCCAATGTCCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-214s21c1
Sequence:CCGGCTGCACAGATGAGAGACAAATCTCGAGATTTGTCTCTCATCTGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008350.1-818s1c1
Sequence:CCGGCCTGTGGCTTATTTATACTTACTCGAGTAAGTATAAATAAGCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-624s1c1
Sequence:CCGGGCTGTTGTTAAAGACTCGACTCTCGAGAGTCGAGTCTTTAACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-217s1c1
Sequence:CCGGGCTGCACAGATGAGAGACAAACTCGAGTTTGTCTCTCATCTGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-459s1c1
Sequence:CCGGCCGCCGTTTACAGCTCTTGATCTCGAGATCAAGAGCTGTAAACGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.3-266s21c1
Sequence:CCGGAGATCTGGACAGCGCTGTTCTCTCGAGAGAACAGCGCTGTCCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-288s21c1
Sequence:CCGGGCTGGGACATTGGGATCTTTGCTCGAGCAAAGATCCCAATGTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.3-326s21c1
Sequence:CCGGTGCACAGATGAGAGACAAATTCTCGAGAATTTGTCTCTCATCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008350.3-918s21c1
Sequence:CCGGGGGATCACCTGTGGCTTATTTCTCGAGAAATAAGCCACAGGTGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008350.2-662s21c1
Sequence:CCGGCCATCGATACCGCCCTTTAAACTCGAGTTTAAAGGGCGGTATCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-323s21c1
Sequence:CCGGGCTGACAAGGCTTCGAGTAGACTCGAGTCTACTCGAAGCCTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-353s21c1
Sequence:CCGGCTACCTCCGGCATGTACAATGCTCGAGCATTGTACATGCCGGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008350
IL11 MISSION shRNA Lentiviral Transduction Particles
interleukin 11
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-291s1c1
Sequence:CCGGCGCTGGGACATTGGGATCTTTCTCGAGAAAGATCCCAATGTCCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-214s21c1
Sequence:CCGGCTGCACAGATGAGAGACAAATCTCGAGATTTGTCTCTCATCTGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008350.1-818s1c1
Sequence:CCGGCCTGTGGCTTATTTATACTTACTCGAGTAAGTATAAATAAGCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-624s1c1
Sequence:CCGGGCTGTTGTTAAAGACTCGACTCTCGAGAGTCGAGTCTTTAACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-217s1c1
Sequence:CCGGGCTGCACAGATGAGAGACAAACTCGAGTTTGTCTCTCATCTGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008350.1-459s1c1
Sequence:CCGGCCGCCGTTTACAGCTCTTGATCTCGAGATCAAGAGCTGTAAACGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.3-266s21c1
Sequence:CCGGAGATCTGGACAGCGCTGTTCTCTCGAGAGAACAGCGCTGTCCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-288s21c1
Sequence:CCGGGCTGGGACATTGGGATCTTTGCTCGAGCAAAGATCCCAATGTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.3-326s21c1
Sequence:CCGGTGCACAGATGAGAGACAAATTCTCGAGAATTTGTCTCTCATCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008350.3-918s21c1
Sequence:CCGGGGGATCACCTGTGGCTTATTTCTCGAGAAATAAGCCACAGGTGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008350.2-662s21c1
Sequence:CCGGCCATCGATACCGCCCTTTAAACTCGAGTTTAAAGGGCGGTATCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-323s21c1
Sequence:CCGGGCTGACAAGGCTTCGAGTAGACTCGAGTCTACTCGAAGCCTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008350.2-353s21c1
Sequence:CCGGCTACCTCCGGCATGTACAATGCTCGAGCATTGTACATGCCGGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000641
VALIDATED
IL11 MISSION shRNA Bacterial Glycerol Stock
interleukin 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-714s1c1
Sequence:CCGGTGCTGCTGAAGACTCGGCTGTCTCGAGACAGCCGAGTCTTCAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000641.2-402s21c1
Sequence:CCGGAGCTCCCAGGTGTGCTGACAACTCGAGTTGTCAGCACACCTGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-484s1c1
Sequence:CCGGCTCTTCCCTGAAGACCCTGGACTCGAGTCCAGGGTCTTCAGGGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000641.2-307s1c1
Sequence:CCGGTGCACAGCTGAGGGACAAATTCTCGAGAATTTGTCCCTCAGCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-262s1c1
Sequence:CCGGCGTGCTCCTGACCCGCTCTCTCTCGAGAGAGAGCGGGTCAGGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-436s1c1
Sequence:CCGGCCTACTGTCCTACCTGCGGCACTCGAGTGCCGCAGGTAGGACAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000641.2-761s21c1
Sequence:CCGGCCTTCCAAAGCCAGATCTTATCTCGAGATAAGATCTGGCTTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000641.2-1180s21c1
Sequence:CCGGATATCCACTTGAGGGCGATTTCTCGAGAAATCGCCCTCAAGTGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000641.2-171s21c1
Sequence:CCGGTGAGCCTGTGGCCAGATACAGCTCGAGCTGTATCTGGCCACAGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000641
VALIDATED
IL11 MISSION shRNA shRNA Plasmid DNA
interleukin 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-714s1c1
Sequence:CCGGTGCTGCTGAAGACTCGGCTGTCTCGAGACAGCCGAGTCTTCAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000641.2-402s21c1
Sequence:CCGGAGCTCCCAGGTGTGCTGACAACTCGAGTTGTCAGCACACCTGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-484s1c1
Sequence:CCGGCTCTTCCCTGAAGACCCTGGACTCGAGTCCAGGGTCTTCAGGGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000641.2-307s1c1
Sequence:CCGGTGCACAGCTGAGGGACAAATTCTCGAGAATTTGTCCCTCAGCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-262s1c1
Sequence:CCGGCGTGCTCCTGACCCGCTCTCTCTCGAGAGAGAGCGGGTCAGGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-436s1c1
Sequence:CCGGCCTACTGTCCTACCTGCGGCACTCGAGTGCCGCAGGTAGGACAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000641.2-761s21c1
Sequence:CCGGCCTTCCAAAGCCAGATCTTATCTCGAGATAAGATCTGGCTTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000641.2-1180s21c1
Sequence:CCGGATATCCACTTGAGGGCGATTTCTCGAGAAATCGCCCTCAAGTGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000641.2-171s21c1
Sequence:CCGGTGAGCCTGTGGCCAGATACAGCTCGAGCTGTATCTGGCCACAGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000641
VALIDATED
IL11 MISSION shRNA Lentiviral Transduction Particles
interleukin 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-714s1c1
Sequence:CCGGTGCTGCTGAAGACTCGGCTGTCTCGAGACAGCCGAGTCTTCAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000641.2-402s21c1
Sequence:CCGGAGCTCCCAGGTGTGCTGACAACTCGAGTTGTCAGCACACCTGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-484s1c1
Sequence:CCGGCTCTTCCCTGAAGACCCTGGACTCGAGTCCAGGGTCTTCAGGGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000641.2-307s1c1
Sequence:CCGGTGCACAGCTGAGGGACAAATTCTCGAGAATTTGTCCCTCAGCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-262s1c1
Sequence:CCGGCGTGCTCCTGACCCGCTCTCTCTCGAGAGAGAGCGGGTCAGGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000641.2-436s1c1
Sequence:CCGGCCTACTGTCCTACCTGCGGCACTCGAGTGCCGCAGGTAGGACAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000641.2-761s21c1
Sequence:CCGGCCTTCCAAAGCCAGATCTTATCTCGAGATAAGATCTGGCTTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000641.2-1180s21c1
Sequence:CCGGATATCCACTTGAGGGCGATTTCTCGAGAAATCGCCCTCAAGTGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000641.2-171s21c1
Sequence:CCGGTGAGCCTGTGGCCAGATACAGCTCGAGCTGTATCTGGCCACAGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)