EMAIL THIS PAGE TO A FRIEND

IL11RA

interleukin 11 receptor, alpha

146 Gene Product Result for
Synonyms: CRSDA
UniProtKB ID: Q14626, Q16542, Q5VZ80, Q7KYJ7
Gene ID:
Human(3590) Summary: Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
Zebrafish(334010) interleukin 11 receptor, alpha
cow(508932) interleukin 11 receptor, alpha
Horse(100068493) interleukin 11 receptor, alpha
domestic cat(101085930) interleukin 11 receptor, alpha
dog(481588) interleukin 11 receptor, alpha
chicken(693251) interleukin 11 receptor, alpha
sheep(101120724) interleukin 11 receptor, alpha
Domestic Rabbit(100349117) interleukin 11 receptor, alpha
domestic guinea pig(100723182) interleukin 11 receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004512 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157431 MISSION® esiRNA esiRNA human IL11RA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004512 Rosetta Predictions human pricing
NM_147162 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156547 predicted 315
2 SASI_Hs01_00156548 predicted 470
3 SASI_Hs01_00156549 predicted 630
4 SASI_Hs01_00156550 predicted 313
5 SASI_Hs01_00156551 predicted 633
6 SASI_Hs02_00337781 predicted 408
7 SASI_Hs01_00156553 predicted 818
8 SASI_Hs01_00156554 predicted 612
9 SASI_Hs01_00156556 predicted 434
10 SASI_Hs02_00337782 predicted 472
11 SASI_Hs01_00156552 predicted 937
12 SASI_Hs01_00156555 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103207 predicted 322
2 SASI_Hs01_00103208 predicted 467
3 SASI_Hs01_00103209 predicted 627
4 SASI_Hs01_00103210 predicted 313
5 SASI_Hs01_00103211 predicted 639
6 SASI_Hs02_00365493 predicted 407
7 SASI_Hs01_00103213 predicted 824
8 SASI_Hs01_00103214 predicted 616
9 SASI_Hs01_00103216 predicted 437
10 SASI_Hs02_00365494 predicted 470
11 SASI_Hs01_00103212 predicted 938
12 SASI_Hs01_00103215 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004512
VALIDATED
IL11RA MISSION shRNA Bacterial Glycerol Stock
interleukin 11 receptor, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-1171s21c1
Sequence:CCGGTGGCGTCTTTGGGAATCCTTTCTCGAGAAAGGATTCCCAAAGACGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-324s21c1
Sequence:CCGGACTGATGAGGGCACCTACATCCTCGAGGATGTAGGTGCCCTCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-627s21c1
Sequence:CCGGTGGAGCCAGTACCGGATTAATCTCGAGATTAATCCGGTACTGGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-433s21c1
Sequence:CCGGCCGACTATGAGAACTTCTCTTCTCGAGAAGAGAAGTTCTCATAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004512.3-1351s21c1
Sequence:CCGGTCGGCAGATTCCACCTATAATCTCGAGATTATAGGTGGAATCTGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004512.3-1352s1c1
Sequence:CCGGCGGCAGATTCCACCTATAATTCTCGAGAATTATAGGTGGAATCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004512.3-1016s1c1
Sequence:CCGGTGGGACCATACCAAAGGAGATCTCGAGATCTCCTTTGGTATGGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-433s1c1
Sequence:CCGGCCGACTATGAGAACTTCTCTTCTCGAGAAGAGAAGTTCTCATAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-824s1c1
Sequence:CCGGGCTCAAGTTCCGTTTGCAGTACTCGAGTACTGCAAACGGAACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-465s1c1
Sequence:CCGGCCCAGCCAGATCAGCGGTTTACTCGAGTAAACCGCTGATCTGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004512
VALIDATED
IL11RA MISSION shRNA shRNA Plasmid DNA
interleukin 11 receptor, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-1171s21c1
Sequence:CCGGTGGCGTCTTTGGGAATCCTTTCTCGAGAAAGGATTCCCAAAGACGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-324s21c1
Sequence:CCGGACTGATGAGGGCACCTACATCCTCGAGGATGTAGGTGCCCTCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-627s21c1
Sequence:CCGGTGGAGCCAGTACCGGATTAATCTCGAGATTAATCCGGTACTGGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-433s21c1
Sequence:CCGGCCGACTATGAGAACTTCTCTTCTCGAGAAGAGAAGTTCTCATAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004512.3-1351s21c1
Sequence:CCGGTCGGCAGATTCCACCTATAATCTCGAGATTATAGGTGGAATCTGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004512.3-1352s1c1
Sequence:CCGGCGGCAGATTCCACCTATAATTCTCGAGAATTATAGGTGGAATCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004512.3-1016s1c1
Sequence:CCGGTGGGACCATACCAAAGGAGATCTCGAGATCTCCTTTGGTATGGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-433s1c1
Sequence:CCGGCCGACTATGAGAACTTCTCTTCTCGAGAAGAGAAGTTCTCATAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-824s1c1
Sequence:CCGGGCTCAAGTTCCGTTTGCAGTACTCGAGTACTGCAAACGGAACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-465s1c1
Sequence:CCGGCCCAGCCAGATCAGCGGTTTACTCGAGTAAACCGCTGATCTGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004512
VALIDATED
IL11RA MISSION shRNA Lentiviral Transduction Particles
interleukin 11 receptor, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-1171s21c1
Sequence:CCGGTGGCGTCTTTGGGAATCCTTTCTCGAGAAAGGATTCCCAAAGACGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-324s21c1
Sequence:CCGGACTGATGAGGGCACCTACATCCTCGAGGATGTAGGTGCCCTCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-627s21c1
Sequence:CCGGTGGAGCCAGTACCGGATTAATCTCGAGATTAATCCGGTACTGGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004512.3-433s21c1
Sequence:CCGGCCGACTATGAGAACTTCTCTTCTCGAGAAGAGAAGTTCTCATAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004512.3-1351s21c1
Sequence:CCGGTCGGCAGATTCCACCTATAATCTCGAGATTATAGGTGGAATCTGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004512.3-1352s1c1
Sequence:CCGGCGGCAGATTCCACCTATAATTCTCGAGAATTATAGGTGGAATCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004512.3-1016s1c1
Sequence:CCGGTGGGACCATACCAAAGGAGATCTCGAGATCTCCTTTGGTATGGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-433s1c1
Sequence:CCGGCCGACTATGAGAACTTCTCTTCTCGAGAAGAGAAGTTCTCATAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-824s1c1
Sequence:CCGGGCTCAAGTTCCGTTTGCAGTACTCGAGTACTGCAAACGGAACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004512.3-465s1c1
Sequence:CCGGCCCAGCCAGATCAGCGGTTTACTCGAGTAAACCGCTGATCTGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)