EMAIL THIS PAGE TO A FRIEND

IL12A

interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)

92 Gene Product Result for
Synonyms: CLMF IL-12A NFSK NKSF1 P35
UniProtKB ID: P29459, Q96QZ1
Gene ID:
Human(3592) Summary: This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
Mouse(16159) interleukin 12a
Rat(84405) interleukin 12A
Zebrafish(445410) interleukin 12a
chicken(407090) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
dog(403977) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
cow(281856) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Horse(100034215) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
domestic cat(493741) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Goat(100861293) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
sheep(443064) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
naked mole-rat(101701392) interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000882 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000882 Rosetta Predictions human pricing
NM_053390 Rosetta Predictions rat pricing
NM_008351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033872 predicted 468
2 SASI_Hs02_00303422 predicted 673
3 SASI_Hs01_00033873 predicted 477
4 SASI_Hs01_00033875 predicted 560
5 SASI_Hs01_00033876 predicted 612
6 SASI_Hs01_00033877 predicted 950
7 SASI_Hs01_00033878 predicted 730
8 SASI_Hs02_00303423 predicted 360
9 SASI_Hs01_00033880 predicted 727
10 SASI_Hs02_00303424 predicted 510
11 SASI_Hs01_00033874 predicted 593
12 SASI_Hs01_00033879 predicted 903
13 SASI_Hs01_00033881 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083702 predicted 256
2 SASI_Rn02_00265887 predicted 472
3 SASI_Rn01_00083704 predicted 551
4 SASI_Rn01_00083705 predicted 301
5 SASI_Rn01_00083706 predicted 398
6 SASI_Rn01_00083707 predicted 319
7 SASI_Rn02_00265888 predicted 498
8 SASI_Rn01_00083709 predicted 521
9 SASI_Rn01_00083710 predicted 483
10 SASI_Rn01_00083711 predicted 269
11 SASI_Rn01_00083703 predicted 499
12 SASI_Rn01_00083708 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178535 predicted 441
2 SASI_Mm01_00178536 predicted 392
3 SASI_Mm01_00178537 predicted 583
4 SASI_Mm01_00178538 predicted 851
5 SASI_Mm01_00178539 predicted 519
6 SASI_Mm02_00313702 predicted 485
7 SASI_Mm01_00178540 predicted 419
8 SASI_Mm01_00178541 predicted 650
9 SASI_Mm01_00178543 predicted 385
10 SASI_Mm01_00178544 predicted 897
11 SASI_Mm01_00178542 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008351
IL12A MISSION shRNA Bacterial Glycerol Stock
interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-200s1c1
Sequence:CCGGCCTCCTAAACCACCTCAGTTTCTCGAGAAACTGAGGTGGTTTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-383s1c1
Sequence:CCGGCAGCACATTGAAGACCTGTTTCTCGAGAAACAGGTCTTCAATGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-702s1c1
Sequence:CCGGGCAGACCCTTACAGAGTGAAACTCGAGTTTCACTCTGTAAGGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-576s1c1
Sequence:CCGGGCACTTCAGAATCACAACCATCTCGAGATGGTTGTGATTCTGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-342s1c1
Sequence:CCGGGCTGAAGACATCGATCATGAACTCGAGTTCATGATCGATGTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008351
IL12A MISSION shRNA shRNA Plasmid DNA
interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-200s1c1
Sequence:CCGGCCTCCTAAACCACCTCAGTTTCTCGAGAAACTGAGGTGGTTTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-383s1c1
Sequence:CCGGCAGCACATTGAAGACCTGTTTCTCGAGAAACAGGTCTTCAATGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-702s1c1
Sequence:CCGGGCAGACCCTTACAGAGTGAAACTCGAGTTTCACTCTGTAAGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-576s1c1
Sequence:CCGGGCACTTCAGAATCACAACCATCTCGAGATGGTTGTGATTCTGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-342s1c1
Sequence:CCGGGCTGAAGACATCGATCATGAACTCGAGTTCATGATCGATGTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008351
IL12A MISSION shRNA Lentiviral Transduction Particles
interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-200s1c1
Sequence:CCGGCCTCCTAAACCACCTCAGTTTCTCGAGAAACTGAGGTGGTTTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-383s1c1
Sequence:CCGGCAGCACATTGAAGACCTGTTTCTCGAGAAACAGGTCTTCAATGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-702s1c1
Sequence:CCGGGCAGACCCTTACAGAGTGAAACTCGAGTTTCACTCTGTAAGGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-576s1c1
Sequence:CCGGGCACTTCAGAATCACAACCATCTCGAGATGGTTGTGATTCTGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008351.1-342s1c1
Sequence:CCGGGCTGAAGACATCGATCATGAACTCGAGTTCATGATCGATGTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000882
IL12A MISSION shRNA Bacterial Glycerol Stock
interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-901s1c1
Sequence:CCGGTCTGCATACTTCTTCATGCTTCTCGAGAAGCATGAAGAAGTATGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-680s1c1
Sequence:CCGGCCTGTGCCTTAGTAGTATTTACTCGAGTAAATACTACTAAGGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-503s1c1
Sequence:CCGGCCCTTGCACTTCTGAAGAGATCTCGAGATCTCTTCAGAAGTGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-618s1c1
Sequence:CCGGGAGACCTCTTTCATAACTAATCTCGAGATTAGTTATGAAAGAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-568s1c1
Sequence:CCGGCCTGTTTACCATTGGAATTAACTCGAGTTAATTCCAATGGTAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000882.2-1097s21c1
Sequence:CCGGTGATACCTCTGATCAAGTATTCTCGAGAATACTTGATCAGAGGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000882.2-1210s21c1
Sequence:CCGGCTTTAATAGAAGGGCAAATATCTCGAGATATTTGCCCTTCTATTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000882
IL12A MISSION shRNA shRNA Plasmid DNA
interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-901s1c1
Sequence:CCGGTCTGCATACTTCTTCATGCTTCTCGAGAAGCATGAAGAAGTATGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-680s1c1
Sequence:CCGGCCTGTGCCTTAGTAGTATTTACTCGAGTAAATACTACTAAGGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-503s1c1
Sequence:CCGGCCCTTGCACTTCTGAAGAGATCTCGAGATCTCTTCAGAAGTGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-618s1c1
Sequence:CCGGGAGACCTCTTTCATAACTAATCTCGAGATTAGTTATGAAAGAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-568s1c1
Sequence:CCGGCCTGTTTACCATTGGAATTAACTCGAGTTAATTCCAATGGTAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000882.2-1097s21c1
Sequence:CCGGTGATACCTCTGATCAAGTATTCTCGAGAATACTTGATCAGAGGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000882.2-1210s21c1
Sequence:CCGGCTTTAATAGAAGGGCAAATATCTCGAGATATTTGCCCTTCTATTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000882
IL12A MISSION shRNA Lentiviral Transduction Particles
interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-901s1c1
Sequence:CCGGTCTGCATACTTCTTCATGCTTCTCGAGAAGCATGAAGAAGTATGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-680s1c1
Sequence:CCGGCCTGTGCCTTAGTAGTATTTACTCGAGTAAATACTACTAAGGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-503s1c1
Sequence:CCGGCCCTTGCACTTCTGAAGAGATCTCGAGATCTCTTCAGAAGTGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-618s1c1
Sequence:CCGGGAGACCTCTTTCATAACTAATCTCGAGATTAGTTATGAAAGAGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000882.2-568s1c1
Sequence:CCGGCCTGTTTACCATTGGAATTAACTCGAGTTAATTCCAATGGTAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000882.2-1097s21c1
Sequence:CCGGTGATACCTCTGATCAAGTATTCTCGAGAATACTTGATCAGAGGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000882.2-1210s21c1
Sequence:CCGGCTTTAATAGAAGGGCAAATATCTCGAGATATTTGCCCTTCTATTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)