EMAIL THIS PAGE TO A FRIEND

IL12B

interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)

131 Gene Product Result for
Synonyms: CLMF CLMF2 IL-12B NKSF NKSF2
UniProtKB ID: P29460
Gene ID:
Human(3593) Summary: This gene encodes a subunit of interleukin 12, a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. This cytokine is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. [provided by RefSeq, Jul 2008]
Mouse(16160) interleukin 12b
Rat(64546) interleukin 12B
chicken(404671) interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
cow(281857) interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Horse(100034222) interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
domestic cat(768273) interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
dog(403976) interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
naked mole-rat(101701309) interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
sheep(443472) interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002187 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002187 Rosetta Predictions human pricing
NM_022611 Rosetta Predictions rat pricing
NM_008352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063736 predicted 553
2 SASI_Hs01_00063737 predicted 297
3 SASI_Hs01_00063738 predicted 592
4 SASI_Hs01_00063739 predicted 293
5 SASI_Hs01_00063740 predicted 305
6 SASI_Hs01_00063741 predicted 370
7 SASI_Hs01_00063742 predicted 485
8 SASI_Hs01_00063743 predicted 1015
9 SASI_Hs01_00063744 predicted 552
10 SASI_Hs01_00063745 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069584 predicted 366
2 SASI_Rn01_00069585 predicted 431
3 SASI_Rn01_00069586 predicted 433
4 SASI_Rn01_00069587 predicted 224
5 SASI_Rn01_00069588 predicted 323
6 SASI_Rn01_00069589 predicted 281
7 SASI_Rn01_00069590 predicted 541
8 SASI_Rn01_00069591 predicted 416
9 SASI_Rn01_00069592 predicted 298
10 SASI_Rn02_00263378 predicted 489
11 SASI_Rn01_00069583 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160882 predicted 594
2 SASI_Mm01_00160883 predicted 767
3 SASI_Mm01_00160884 predicted 939
4 SASI_Mm01_00160885 predicted 524
5 SASI_Mm01_00160886 predicted 1076
6 SASI_Mm01_00160887 predicted 589
7 SASI_Mm01_00160888 predicted 233
8 SASI_Mm01_00160889 predicted 386
9 SASI_Mm01_00160890 predicted 674
10 SASI_Mm01_00160891 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008352
IL12B MISSION shRNA Bacterial Glycerol Stock
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008352.2-1352s21c1
Sequence:CCGGAGCTAATGTATGCATAGATATCTCGAGATATCTATGCATACATTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008352.2-1098s21c1
Sequence:CCGGGCAAGCTCAGGATCGCTATTACTCGAGTAATAGCGATCCTGAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008352.2-977s21c1
Sequence:CCGGTTCGAATCCAGCGCAAGAAAGCTCGAGCTTTCTTGCGCTGGATTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008352.2-1648s21c1
Sequence:CCGGGTAAAGACATAGGTGGTATTTCTCGAGAAATACCACCTATGTCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008352.1-1508s1c1
Sequence:CCGGCCAGGCCCTATTATGCAAATTCTCGAGAATTTGCATAATAGGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-238s1c1
Sequence:CCGGCTGGAGAAAGACGTTTATGTTCTCGAGAACATAAACGTCTTTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-537s1c1
Sequence:CCGGCCTGAAGTGTGAAGCACCAAACTCGAGTTTGGTGCTTCACACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-796s1c1
Sequence:CCGGGCACGGCAGCAGAATAAATATCTCGAGATATTTATTCTGCTGCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-948s1c1
Sequence:CCGGCCATTCCTACTTCTCCCTCAACTCGAGTTGAGGGAGAAGTAGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008352
IL12B MISSION shRNA shRNA Plasmid DNA
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008352.2-1352s21c1
Sequence:CCGGAGCTAATGTATGCATAGATATCTCGAGATATCTATGCATACATTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008352.2-1098s21c1
Sequence:CCGGGCAAGCTCAGGATCGCTATTACTCGAGTAATAGCGATCCTGAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008352.2-977s21c1
Sequence:CCGGTTCGAATCCAGCGCAAGAAAGCTCGAGCTTTCTTGCGCTGGATTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008352.2-1648s21c1
Sequence:CCGGGTAAAGACATAGGTGGTATTTCTCGAGAAATACCACCTATGTCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008352.1-1508s1c1
Sequence:CCGGCCAGGCCCTATTATGCAAATTCTCGAGAATTTGCATAATAGGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-238s1c1
Sequence:CCGGCTGGAGAAAGACGTTTATGTTCTCGAGAACATAAACGTCTTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-537s1c1
Sequence:CCGGCCTGAAGTGTGAAGCACCAAACTCGAGTTTGGTGCTTCACACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-796s1c1
Sequence:CCGGGCACGGCAGCAGAATAAATATCTCGAGATATTTATTCTGCTGCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-948s1c1
Sequence:CCGGCCATTCCTACTTCTCCCTCAACTCGAGTTGAGGGAGAAGTAGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008352
IL12B MISSION shRNA Lentiviral Transduction Particles
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008352.2-1352s21c1
Sequence:CCGGAGCTAATGTATGCATAGATATCTCGAGATATCTATGCATACATTAGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008352.2-1098s21c1
Sequence:CCGGGCAAGCTCAGGATCGCTATTACTCGAGTAATAGCGATCCTGAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008352.2-977s21c1
Sequence:CCGGTTCGAATCCAGCGCAAGAAAGCTCGAGCTTTCTTGCGCTGGATTCGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008352.2-1648s21c1
Sequence:CCGGGTAAAGACATAGGTGGTATTTCTCGAGAAATACCACCTATGTCTTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008352.1-1508s1c1
Sequence:CCGGCCAGGCCCTATTATGCAAATTCTCGAGAATTTGCATAATAGGGCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-238s1c1
Sequence:CCGGCTGGAGAAAGACGTTTATGTTCTCGAGAACATAAACGTCTTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-537s1c1
Sequence:CCGGCCTGAAGTGTGAAGCACCAAACTCGAGTTTGGTGCTTCACACTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-796s1c1
Sequence:CCGGGCACGGCAGCAGAATAAATATCTCGAGATATTTATTCTGCTGCCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008352.1-948s1c1
Sequence:CCGGCCATTCCTACTTCTCCCTCAACTCGAGTTGAGGGAGAAGTAGGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002187
IL12B MISSION shRNA Bacterial Glycerol Stock
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002187.2-1252s21c1
Sequence:CCGCCCATGGGCCTTCATGCTATTTCTCGAGAAATAGCATGAAGGCCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002187.2-1186s21c1
Sequence:CCGGTTAGATGCTAAATGCTCATTGCTCGAGCAATGAGCATTTAGCATCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-493s1c1
Sequence:CCGGGATTTGACATTCAGTGTCAAACTCGAGTTTGACACTGAATGTCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-682s1c1
Sequence:CCGGGCCGTTCACAAGCTCAAGTATCTCGAGATACTTGAGCTTGTGAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-440s1c1
Sequence:CCGGCCAAGAATTATTCTGGACGTTCTCGAGAACGTCCAGAATAATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002187.2-371s21c1
Sequence:CCGGGAATTTGGTCCACTGATATTTCTCGAGAAATATCAGTGGACCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-136s1c1
Sequence:CCGGGTCGTAGAATTGGATTGGTATCTCGAGATACCAATCCAATTCTACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002187
IL12B MISSION shRNA shRNA Plasmid DNA
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002187.2-1252s21c1
Sequence:CCGCCCATGGGCCTTCATGCTATTTCTCGAGAAATAGCATGAAGGCCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002187.2-1186s21c1
Sequence:CCGGTTAGATGCTAAATGCTCATTGCTCGAGCAATGAGCATTTAGCATCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-493s1c1
Sequence:CCGGGATTTGACATTCAGTGTCAAACTCGAGTTTGACACTGAATGTCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-682s1c1
Sequence:CCGGGCCGTTCACAAGCTCAAGTATCTCGAGATACTTGAGCTTGTGAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-440s1c1
Sequence:CCGGCCAAGAATTATTCTGGACGTTCTCGAGAACGTCCAGAATAATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002187.2-371s21c1
Sequence:CCGGGAATTTGGTCCACTGATATTTCTCGAGAAATATCAGTGGACCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-136s1c1
Sequence:CCGGGTCGTAGAATTGGATTGGTATCTCGAGATACCAATCCAATTCTACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002187
IL12B MISSION shRNA Lentiviral Transduction Particles
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002187.2-1252s21c1
Sequence:CCGCCCATGGGCCTTCATGCTATTTCTCGAGAAATAGCATGAAGGCCCATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002187.2-1186s21c1
Sequence:CCGGTTAGATGCTAAATGCTCATTGCTCGAGCAATGAGCATTTAGCATCTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-493s1c1
Sequence:CCGGGATTTGACATTCAGTGTCAAACTCGAGTTTGACACTGAATGTCAAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-682s1c1
Sequence:CCGGGCCGTTCACAAGCTCAAGTATCTCGAGATACTTGAGCTTGTGAACGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-440s1c1
Sequence:CCGGCCAAGAATTATTCTGGACGTTCTCGAGAACGTCCAGAATAATTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002187.2-371s21c1
Sequence:CCGGGAATTTGGTCCACTGATATTTCTCGAGAAATATCAGTGGACCAAATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002187.2-136s1c1
Sequence:CCGGGTCGTAGAATTGGATTGGTATCTCGAGATACCAATCCAATTCTACGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)