EMAIL THIS PAGE TO A FRIEND

IL12RB1

interleukin 12 receptor, beta 1

69 Gene Product Result for
Synonyms: CD212 IL-12R-BETA1 IL12RB
UniProtKB ID: P42701, A8K308, B2RPF1, B7ZKK3, Q8N6Q7
Gene ID:
Human(3594) Summary: The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The lack of expression of this gene was found to result in the immunodeficiency of patients with severe mycobacterial and Salmonella infections. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(16161) interleukin 12 receptor, beta 1
Rat(171333) interleukin 12 receptor, beta 1
chicken(101665925) interleukin 12 receptor, beta 1
chicken(101749221) interleukin 12 receptor, beta 1
cow(524299) interleukin 12 receptor, beta 1
domestic cat(101093085) interleukin 12 receptor, beta 1
dog(484828) interleukin 12 receptor, beta 1
sheep(101110054) interleukin 12 receptor, beta 1
domestic guinea pig(100715293) interleukin 12 receptor, beta 1
naked mole-rat(101702338) interleukin 12 receptor, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005535 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132801 MISSION® esiRNA esiRNA human IL12RB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005535 Rosetta Predictions human pricing
NM_153701 Rosetta Predictions human pricing
XM_001070117 Rosetta Predictions rat pricing
XM_344493 Rosetta Predictions rat pricing
NM_008353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246831 predicted 206
2 SASI_Hs01_00246832 predicted 385
3 SASI_Hs01_00246833 predicted 457
4 SASI_Hs01_00246834 predicted 457
5 SASI_Hs01_00246835 predicted 489
6 SASI_Hs01_00246836 predicted 391
7 SASI_Hs01_00246837 predicted 204
8 SASI_Hs02_00339771 predicted 718
9 SASI_Hs01_00246838 predicted 224
10 SASI_Hs01_00246839 predicted 426
11 SASI_Hs01_00246840 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106926 predicted 200
2 SASI_Hs01_00106927 predicted 390
3 SASI_Hs01_00106928 predicted 457
4 SASI_Hs01_00106929 predicted 455
5 SASI_Hs01_00106930 predicted 488
6 SASI_Hs01_00106931 predicted 390
7 SASI_Hs01_00106932 predicted 201
8 SASI_Hs02_00367417 predicted 710
9 SASI_Hs01_00106933 predicted 216
10 SASI_Hs01_00106934 predicted 424
11 SASI_Hs01_00106935 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330491 predicted 562
2 SASI_Rn02_00330492 predicted 411
3 SASI_Rn02_00330493 predicted 1688
4 SASI_Rn02_00330494 predicted 607
5 SASI_Rn02_00330495 predicted 833
6 SASI_Rn02_00330496 predicted 732
7 SASI_Rn02_00330497 predicted 337
8 SASI_Rn02_00330498 predicted 676
9 SASI_Rn02_00330499 predicted 335
10 SASI_Rn02_00330500 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397161 predicted 409
2 SASI_Rn02_00397162 predicted 1250
3 SASI_Rn02_00397163 predicted 1044
4 SASI_Rn02_00397164 predicted 321
5 SASI_Rn02_00397165 predicted 323
6 SASI_Rn02_00397166 predicted 594
7 SASI_Rn02_00397167 predicted 336
8 SASI_Rn02_00397168 predicted 1155
9 SASI_Rn02_00397169 predicted 1193
10 SASI_Rn02_00397170 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097440 predicted 655
2 SASI_Mm02_00313703 predicted 928
3 SASI_Mm01_00097441 predicted 2236
4 SASI_Mm01_00097442 predicted 1787
5 SASI_Mm01_00097443 predicted 1103
6 SASI_Mm01_00097444 predicted 1397
7 SASI_Mm01_00097445 predicted 2416
8 SASI_Mm01_00097447 predicted 342
9 SASI_Mm01_00097448 predicted 836
10 SASI_Mm01_00097449 predicted 2253
11 SASI_Mm01_00097446 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005535
IL12RB1 MISSION shRNA Bacterial Glycerol Stock
interleukin 12 receptor, beta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-209s1c1
Sequence:CCGGGACCTGAGATGCTATCGGATACTCGAGTATCCGATAGCATCTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1517s1c1
Sequence:CCGGTGCCGAGATGAAGACAGCAAACTCGAGTTTGCTGTCTTCATCTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1300s1c1
Sequence:CCGGGTGTTACTACATTACCATCTTCTCGAGAAGATGGTAATGTAGTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-458s1c1
Sequence:CCGGCAGCTCTACAACTCAGTTAAACTCGAGTTTAACTGAGTTGTAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1155s1c1
Sequence:CCGGGCATGACGTATTGCATTGAATCTCGAGATTCAATGCAATACGTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1417s21c1
Sequence:CCGGCGTCTCGGTGAAGAATCATAGCTCGAGCTATGATTCTTCACCGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1116s21c1
Sequence:CCGGCCAACGGGACCACCATGTATTCTCGAGAATACATGGTGGTCCCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1016s21c1
Sequence:CCGGGTCATCTCCTCGAACCAATTTCTCGAGAAATTGGTTCGAGGAGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005535
IL12RB1 MISSION shRNA shRNA Plasmid DNA
interleukin 12 receptor, beta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-209s1c1
Sequence:CCGGGACCTGAGATGCTATCGGATACTCGAGTATCCGATAGCATCTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1517s1c1
Sequence:CCGGTGCCGAGATGAAGACAGCAAACTCGAGTTTGCTGTCTTCATCTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1300s1c1
Sequence:CCGGGTGTTACTACATTACCATCTTCTCGAGAAGATGGTAATGTAGTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-458s1c1
Sequence:CCGGCAGCTCTACAACTCAGTTAAACTCGAGTTTAACTGAGTTGTAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1155s1c1
Sequence:CCGGGCATGACGTATTGCATTGAATCTCGAGATTCAATGCAATACGTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1417s21c1
Sequence:CCGGCGTCTCGGTGAAGAATCATAGCTCGAGCTATGATTCTTCACCGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1116s21c1
Sequence:CCGGCCAACGGGACCACCATGTATTCTCGAGAATACATGGTGGTCCCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1016s21c1
Sequence:CCGGGTCATCTCCTCGAACCAATTTCTCGAGAAATTGGTTCGAGGAGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005535
IL12RB1 MISSION shRNA Lentiviral Transduction Particles
interleukin 12 receptor, beta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-209s1c1
Sequence:CCGGGACCTGAGATGCTATCGGATACTCGAGTATCCGATAGCATCTCAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1517s1c1
Sequence:CCGGTGCCGAGATGAAGACAGCAAACTCGAGTTTGCTGTCTTCATCTCGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1300s1c1
Sequence:CCGGGTGTTACTACATTACCATCTTCTCGAGAAGATGGTAATGTAGTAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-458s1c1
Sequence:CCGGCAGCTCTACAACTCAGTTAAACTCGAGTTTAACTGAGTTGTAGAGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005535.1-1155s1c1
Sequence:CCGGGCATGACGTATTGCATTGAATCTCGAGATTCAATGCAATACGTCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1417s21c1
Sequence:CCGGCGTCTCGGTGAAGAATCATAGCTCGAGCTATGATTCTTCACCGAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1116s21c1
Sequence:CCGGCCAACGGGACCACCATGTATTCTCGAGAATACATGGTGGTCCCGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005535.1-1016s21c1
Sequence:CCGGGTCATCTCCTCGAACCAATTTCTCGAGAAATTGGTTCGAGGAGATGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008353
IL12RB1 MISSION shRNA Bacterial Glycerol Stock
interleukin 12 receptor, beta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-2199s1c1
Sequence:CCGGCCTCTGTACTTGACGATCTTTCTCGAGAAAGATCGTCAAGTACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-610s1c1
Sequence:CCGGGCCCACAACGAATTGGACCTTCTCGAGAAGGTCCAATTCGTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-211s1c1
Sequence:CCGGGAGTTGCTACAGGGTTTCCAACTCGAGTTGGAAACCCTGTAGCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-1739s1c1
Sequence:CCGGGAGGTGCAGATTTCCCGTTTACTCGAGTAAACGGGAAATCTGCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-2212s1c1
Sequence:CCGGCGATCTTTGGAGGACCCATAACTCGAGTTATGGGTCCTCCAAAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008353
IL12RB1 MISSION shRNA shRNA Plasmid DNA
interleukin 12 receptor, beta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-2199s1c1
Sequence:CCGGCCTCTGTACTTGACGATCTTTCTCGAGAAAGATCGTCAAGTACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-610s1c1
Sequence:CCGGGCCCACAACGAATTGGACCTTCTCGAGAAGGTCCAATTCGTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-211s1c1
Sequence:CCGGGAGTTGCTACAGGGTTTCCAACTCGAGTTGGAAACCCTGTAGCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-1739s1c1
Sequence:CCGGGAGGTGCAGATTTCCCGTTTACTCGAGTAAACGGGAAATCTGCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-2212s1c1
Sequence:CCGGCGATCTTTGGAGGACCCATAACTCGAGTTATGGGTCCTCCAAAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008353
IL12RB1 MISSION shRNA Lentiviral Transduction Particles
interleukin 12 receptor, beta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-2199s1c1
Sequence:CCGGCCTCTGTACTTGACGATCTTTCTCGAGAAAGATCGTCAAGTACAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-610s1c1
Sequence:CCGGGCCCACAACGAATTGGACCTTCTCGAGAAGGTCCAATTCGTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-211s1c1
Sequence:CCGGGAGTTGCTACAGGGTTTCCAACTCGAGTTGGAAACCCTGTAGCAACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-1739s1c1
Sequence:CCGGGAGGTGCAGATTTCCCGTTTACTCGAGTAAACGGGAAATCTGCACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008353.1-2212s1c1
Sequence:CCGGCGATCTTTGGAGGACCCATAACTCGAGTTATGGGTCCTCCAAAGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)