EMAIL THIS PAGE TO A FRIEND

IL12RB2

interleukin 12 receptor, beta 2

70 Gene Product Result for
UniProtKB ID: Q99665, B1AN98, B7ZKL9, F5H7L6, Q2M3V3
Gene ID:
Human(3595) Summary: The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(16162) interleukin 12 receptor, beta 2
Rat(171334) interleukin 12 receptor, beta 2
domestic guinea pig(100722774) interleukin 12 receptor, beta 2
naked mole-rat(101717608) interleukin 12 receptor, beta 2
sheep(100820736) interleukin 12 receptor, beta 2
Domestic Rabbit(100350416) interleukin 12 receptor, beta 2
Zebrafish(100134971) interleukin 12 receptor, beta 2a
cow(282452) interleukin 12 receptor, beta 2
domestic cat(101088012) interleukin 12 receptor, beta 2
dog(489550) interleukin 12 receptor, beta 2
chicken(424705) interleukin 12 receptor, beta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160761 MISSION® esiRNA esiRNA human IL12RB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001559 Rosetta Predictions human pricing
XM_001067506 Rosetta Predictions rat pricing
XM_231873 Rosetta Predictions rat pricing
NM_008354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229145 predicted 2642
2 SASI_Hs01_00229146 predicted 1090
3 SASI_Hs01_00229147 predicted 1633
4 SASI_Hs01_00229148 predicted 1856
5 SASI_Hs01_00229149 predicted 3031
6 SASI_Hs02_00332129 predicted 3231
7 SASI_Hs01_00229150 predicted 1523
8 SASI_Hs02_00332130 predicted 2517
9 SASI_Hs01_00229151 predicted 2921
10 SASI_Hs01_00229152 predicted 2496
11 SASI_Hs01_00229153 predicted 1610
12 SASI_Hs01_00229154 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321193 predicted 2313
2 SASI_Rn02_00321194 predicted 270
3 SASI_Rn02_00321195 predicted 496
4 SASI_Rn02_00321196 predicted 1118
5 SASI_Rn02_00321197 predicted 541
6 SASI_Rn02_00321198 predicted 2282
7 SASI_Rn02_00321199 predicted 879
8 SASI_Rn02_00321200 predicted 552
9 SASI_Rn02_00321201 predicted 1265
10 SASI_Rn02_00321202 predicted 1952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386961 predicted 2311
2 SASI_Rn02_00386962 predicted 267
3 SASI_Rn02_00386963 predicted 496
4 SASI_Rn02_00386964 predicted 1115
5 SASI_Rn02_00386965 predicted 533
6 SASI_Rn02_00386966 predicted 2282
7 SASI_Rn02_00386967 predicted 878
8 SASI_Rn02_00386968 predicted 549
9 SASI_Rn02_00386969 predicted 1265
10 SASI_Rn02_00386970 predicted 1956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081815 predicted 631
2 SASI_Mm01_00081816 predicted 554
3 SASI_Mm02_00313704 predicted 1267
4 SASI_Mm01_00081818 predicted 2419
5 SASI_Mm01_00081819 predicted 1400
6 SASI_Mm01_00081820 predicted 736
7 SASI_Mm01_00081821 predicted 470
8 SASI_Mm02_00313705 predicted 1082
9 SASI_Mm01_00081822 predicted 2556
10 SASI_Mm01_00081823 predicted 2462
11 SASI_Mm01_00081814 predicted 1257
12 SASI_Mm01_00081817 predicted 2189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001559
IL12RB2 MISSION shRNA Bacterial Glycerol Stock
interleukin 12 receptor, beta 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-2061s21c1
Sequence:CCGGTACGGAGTCGACCCTACAATGCTCGAGCATTGTAGGGTCGACTCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-3036s21c1
Sequence:CCGGGCTACTTACCCTCCAACATAGCTCGAGCTATGTTGGAGGGTAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-826s21c1
Sequence:CCGGTTCCAGACGTAACAAGTTAATCTCGAGATTAACTTGTTACGTCTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-951s1c1
Sequence:CCGGCCTGTATCAATAGTGATGAAACTCGAGTTTCATCACTATTGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2176s1c1
Sequence:CCGGCCTGGGTAACTCTAAGCACAACTCGAGTTGTGCTTAGAGTTACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-1092s1c1
Sequence:CCGGCCCACTTATACACTGAGTATACTCGAGTATACTCAGTGTATAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2464s1c1
Sequence:CCGGCCACGGAAATGAGAGGGAATTCTCGAGAATTCCCTCTCATTTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2296s1c1
Sequence:CCGGCCTCCTCCATTATAGGATATACTCGAGTATATCCTATAATGGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001559
IL12RB2 MISSION shRNA shRNA Plasmid DNA
interleukin 12 receptor, beta 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-2061s21c1
Sequence:CCGGTACGGAGTCGACCCTACAATGCTCGAGCATTGTAGGGTCGACTCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-3036s21c1
Sequence:CCGGGCTACTTACCCTCCAACATAGCTCGAGCTATGTTGGAGGGTAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-826s21c1
Sequence:CCGGTTCCAGACGTAACAAGTTAATCTCGAGATTAACTTGTTACGTCTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-951s1c1
Sequence:CCGGCCTGTATCAATAGTGATGAAACTCGAGTTTCATCACTATTGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2176s1c1
Sequence:CCGGCCTGGGTAACTCTAAGCACAACTCGAGTTGTGCTTAGAGTTACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-1092s1c1
Sequence:CCGGCCCACTTATACACTGAGTATACTCGAGTATACTCAGTGTATAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2464s1c1
Sequence:CCGGCCACGGAAATGAGAGGGAATTCTCGAGAATTCCCTCTCATTTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2296s1c1
Sequence:CCGGCCTCCTCCATTATAGGATATACTCGAGTATATCCTATAATGGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001559
IL12RB2 MISSION shRNA Lentiviral Transduction Particles
interleukin 12 receptor, beta 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-2061s21c1
Sequence:CCGGTACGGAGTCGACCCTACAATGCTCGAGCATTGTAGGGTCGACTCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-3036s21c1
Sequence:CCGGGCTACTTACCCTCCAACATAGCTCGAGCTATGTTGGAGGGTAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001559.2-826s21c1
Sequence:CCGGTTCCAGACGTAACAAGTTAATCTCGAGATTAACTTGTTACGTCTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-951s1c1
Sequence:CCGGCCTGTATCAATAGTGATGAAACTCGAGTTTCATCACTATTGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2176s1c1
Sequence:CCGGCCTGGGTAACTCTAAGCACAACTCGAGTTGTGCTTAGAGTTACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-1092s1c1
Sequence:CCGGCCCACTTATACACTGAGTATACTCGAGTATACTCAGTGTATAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2464s1c1
Sequence:CCGGCCACGGAAATGAGAGGGAATTCTCGAGAATTCCCTCTCATTTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001559.2-2296s1c1
Sequence:CCGGCCTCCTCCATTATAGGATATACTCGAGTATATCCTATAATGGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008354
IL12RB2 MISSION shRNA Bacterial Glycerol Stock
interleukin 12 receptor, beta 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-767s1c1
Sequence:CCGGCCAGGTTCATAGTCCGTGTTACTCGAGTAACACGGACTATGAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-1630s1c1
Sequence:CCGGGCTCTGATTTCAGAGAACATACTCGAGTATGTTCTCTGAAATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-2450s1c1
Sequence:CCGGCCAGACAACTAGTGAACCTATCTCGAGATAGGTTCACTAGTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-2006s1c1
Sequence:CCGGCCCAAGGAAATGAAAGGGAATCTCGAGATTCCCTTTCATTTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-192s1c1
Sequence:CCGGGCTGCTGATTAAAGCAAATATCTCGAGATATTTGCTTTAATCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008354
IL12RB2 MISSION shRNA shRNA Plasmid DNA
interleukin 12 receptor, beta 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-767s1c1
Sequence:CCGGCCAGGTTCATAGTCCGTGTTACTCGAGTAACACGGACTATGAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-1630s1c1
Sequence:CCGGGCTCTGATTTCAGAGAACATACTCGAGTATGTTCTCTGAAATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-2450s1c1
Sequence:CCGGCCAGACAACTAGTGAACCTATCTCGAGATAGGTTCACTAGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-2006s1c1
Sequence:CCGGCCCAAGGAAATGAAAGGGAATCTCGAGATTCCCTTTCATTTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-192s1c1
Sequence:CCGGGCTGCTGATTAAAGCAAATATCTCGAGATATTTGCTTTAATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008354
IL12RB2 MISSION shRNA Lentiviral Transduction Particles
interleukin 12 receptor, beta 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-767s1c1
Sequence:CCGGCCAGGTTCATAGTCCGTGTTACTCGAGTAACACGGACTATGAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-1630s1c1
Sequence:CCGGGCTCTGATTTCAGAGAACATACTCGAGTATGTTCTCTGAAATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-2450s1c1
Sequence:CCGGCCAGACAACTAGTGAACCTATCTCGAGATAGGTTCACTAGTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-2006s1c1
Sequence:CCGGCCCAAGGAAATGAAAGGGAATCTCGAGATTCCCTTTCATTTCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008354.1-192s1c1
Sequence:CCGGGCTGCTGATTAAAGCAAATATCTCGAGATATTTGCTTTAATCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)