EMAIL THIS PAGE TO A FRIEND

IL13

interleukin 13

128 Gene Product Result for
Synonyms: IL-13 P600
UniProtKB ID: P35225, O43644, Q4VB52, Q9UDC7
Gene ID:
Human(3596) Summary: This gene encodes an immunoregulatory cytokine produced primarily by activated Th2 cells. This cytokine is involved in several stages of B-cell maturation and differentiation. It up-regulates CD23 and MHC class II expression, and promotes IgE isotype switching of B cells. This cytokine down-regulates macrophage activity, thereby inhibits the production of pro-inflammatory cytokines and chemokines. This cytokine is found to be critical to the pathogenesis of allergen-induced asthma but operates through mechanisms independent of IgE and eosinophils. This gene, IL3, IL5, IL4, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL4. [provided by RefSeq, Jul 2008]
Mouse(16163) interleukin 13
Rat(116553) interleukin 13
Zebrafish(794053) interleukin 13
cow(281247) interleukin 13
domestic cat(101084678) interleukin 13
chicken(474361) interleukin 13
dog(442990) interleukin 13
sheep(664707) interleukin 13
naked mole-rat(101718152) interleukin 13
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002188 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136601 MISSION® esiRNA esiRNA human IL13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002188 Rosetta Predictions human pricing
NM_053828 Rosetta Predictions rat pricing
NM_008355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015515 predicted 471
2 SASI_Hs01_00015516 predicted 867
3 SASI_Hs01_00015517 predicted 220
4 SASI_Hs01_00015518 predicted 874
5 SASI_Hs01_00015519 predicted 358
6 SASI_Hs01_00015520 predicted 293
7 SASI_Hs01_00015521 predicted 729
8 SASI_Hs01_00015522 predicted 469
9 SASI_Hs01_00015523 predicted 383
10 SASI_Hs01_00015524 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076933 predicted 205
2 SASI_Rn01_00076934 predicted 217
3 SASI_Rn01_00076935 predicted 206
4 SASI_Rn01_00076936 predicted 199
5 SASI_Rn01_00076937 predicted 215
6 SASI_Rn01_00076938 predicted 210
7 SASI_Rn01_00076939 predicted 205
8 SASI_Rn01_00076940 predicted 214
9 SASI_Rn01_00076941 predicted 263
10 SASI_Rn01_00076942 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129418 predicted 885
2 SASI_Mm02_00313706 predicted 874
3 SASI_Mm01_00129419 predicted 328
4 SASI_Mm01_00129420 predicted 278
5 SASI_Mm01_00129421 predicted 393
6 SASI_Mm02_00313707 predicted 885
7 SASI_Mm02_00313708 predicted 280
8 SASI_Mm01_00129423 predicted 318
9 SASI_Mm01_00129424 predicted 960
10 SASI_Mm01_00129417 predicted 395
11 SASI_Mm01_00129422 predicted 264
12 SASI_Mm01_00129425 predicted 301
13 SASI_Mm01_00129426 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008355
IL13 MISSION shRNA Bacterial Glycerol Stock
interleukin 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-284s1c1
Sequence:CCGGCCCTGACCAACATCTCCAATTCTCGAGAATTGGAGATGTTGGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-160s1c1
Sequence:CCGGCTGACCCTTAAGGAGCTTATTCTCGAGAATAAGCTCCTTAAGGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-421s1c1
Sequence:CCGGCTGCTCAGCTACACAAAGCAACTCGAGTTGCTTTGTGTAGCTGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-330s1c1
Sequence:CCGGGATATTGCATGGCCTCTGTAACTCGAGTTACAGAGGCCATGCAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-186s1c1
Sequence:CCGGGCTGAGCAACATCACACAAGACTCGAGTCTTGTGTGATGTTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008355
IL13 MISSION shRNA shRNA Plasmid DNA
interleukin 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-284s1c1
Sequence:CCGGCCCTGACCAACATCTCCAATTCTCGAGAATTGGAGATGTTGGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-160s1c1
Sequence:CCGGCTGACCCTTAAGGAGCTTATTCTCGAGAATAAGCTCCTTAAGGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-421s1c1
Sequence:CCGGCTGCTCAGCTACACAAAGCAACTCGAGTTGCTTTGTGTAGCTGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-330s1c1
Sequence:CCGGGATATTGCATGGCCTCTGTAACTCGAGTTACAGAGGCCATGCAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-186s1c1
Sequence:CCGGGCTGAGCAACATCACACAAGACTCGAGTCTTGTGTGATGTTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008355
IL13 MISSION shRNA Lentiviral Transduction Particles
interleukin 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-284s1c1
Sequence:CCGGCCCTGACCAACATCTCCAATTCTCGAGAATTGGAGATGTTGGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-160s1c1
Sequence:CCGGCTGACCCTTAAGGAGCTTATTCTCGAGAATAAGCTCCTTAAGGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-421s1c1
Sequence:CCGGCTGCTCAGCTACACAAAGCAACTCGAGTTGCTTTGTGTAGCTGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-330s1c1
Sequence:CCGGGATATTGCATGGCCTCTGTAACTCGAGTTACAGAGGCCATGCAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008355.1-186s1c1
Sequence:CCGGGCTGAGCAACATCACACAAGACTCGAGTCTTGTGTGATGTTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002188
IL13 MISSION shRNA Bacterial Glycerol Stock
interleukin 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-73s1c1
Sequence:CCGGCCACGGTCATTGCTCTCACTTCTCGAGAAGTGAGAGCAATGACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-407s1c1
Sequence:CCGGCCTGCTCTTACATTTAAAGAACTCGAGTTCTTTAAATGTAAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-206s1c1
Sequence:CCGGCAGCATGGTATGGAGCATCAACTCGAGTTGATGCTCCATACCATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-392s1c1
Sequence:CCGGCCAGTTTGTAAAGGACCTGCTCTCGAGAGCAGGTCCTTTACAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-302s1c1
Sequence:CCGGCCAGAGGATGCTGAGCGGATTCTCGAGAATCCGCTCAGCATCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002188.2-457s21c1
Sequence:CCGGACTTCGAAAGCATCATTATTTCTCGAGAAATAATGATGCTTTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002188.2-497s21c1
Sequence:CCGGATTGAAGTTGCAGATTCATTTCTCGAGAAATGAATCTGCAACTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002188.2-152s21c1
Sequence:CCGGCATTGAGGAGCTGGTCAACATCTCGAGATGTTGACCAGCTCCTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002188
IL13 MISSION shRNA shRNA Plasmid DNA
interleukin 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-73s1c1
Sequence:CCGGCCACGGTCATTGCTCTCACTTCTCGAGAAGTGAGAGCAATGACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-407s1c1
Sequence:CCGGCCTGCTCTTACATTTAAAGAACTCGAGTTCTTTAAATGTAAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-206s1c1
Sequence:CCGGCAGCATGGTATGGAGCATCAACTCGAGTTGATGCTCCATACCATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-392s1c1
Sequence:CCGGCCAGTTTGTAAAGGACCTGCTCTCGAGAGCAGGTCCTTTACAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-302s1c1
Sequence:CCGGCCAGAGGATGCTGAGCGGATTCTCGAGAATCCGCTCAGCATCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002188.2-457s21c1
Sequence:CCGGACTTCGAAAGCATCATTATTTCTCGAGAAATAATGATGCTTTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002188.2-497s21c1
Sequence:CCGGATTGAAGTTGCAGATTCATTTCTCGAGAAATGAATCTGCAACTTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002188.2-152s21c1
Sequence:CCGGCATTGAGGAGCTGGTCAACATCTCGAGATGTTGACCAGCTCCTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002188
IL13 MISSION shRNA Lentiviral Transduction Particles
interleukin 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-73s1c1
Sequence:CCGGCCACGGTCATTGCTCTCACTTCTCGAGAAGTGAGAGCAATGACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-407s1c1
Sequence:CCGGCCTGCTCTTACATTTAAAGAACTCGAGTTCTTTAAATGTAAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-206s1c1
Sequence:CCGGCAGCATGGTATGGAGCATCAACTCGAGTTGATGCTCCATACCATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-392s1c1
Sequence:CCGGCCAGTTTGTAAAGGACCTGCTCTCGAGAGCAGGTCCTTTACAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002188.2-302s1c1
Sequence:CCGGCCAGAGGATGCTGAGCGGATTCTCGAGAATCCGCTCAGCATCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002188.2-457s21c1
Sequence:CCGGACTTCGAAAGCATCATTATTTCTCGAGAAATAATGATGCTTTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002188.2-497s21c1
Sequence:CCGGATTGAAGTTGCAGATTCATTTCTCGAGAAATGAATCTGCAACTTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002188.2-152s21c1
Sequence:CCGGCATTGAGGAGCTGGTCAACATCTCGAGATGTTGACCAGCTCCTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)