EMAIL THIS PAGE TO A FRIEND

IL13RA1

interleukin 13 receptor, alpha 1

159 Gene Product Result for
Synonyms: CD213A1 IL-13Ra NR4
UniProtKB ID: P78552, O95646, Q5JSL4, Q99656
Gene ID:
Human(3597) Summary: The protein encoded by this gene is a subunit of the interleukin 13 receptor. This subunit forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors. This subunit serves as a primary IL13-binding subunit of the IL13 receptor, and may also be a component of IL4 receptors. This protein has been shown to bind tyrosine kinase TYK2, and thus may mediate the signaling processes that lead to the activation of JAK1, STAT3 and STAT6 induced by IL13 and IL4. [provided by RefSeq, Jul 2008]
Mouse(16164) interleukin 13 receptor, alpha 1
Rat(252963) interleukin 13 receptor, alpha 1
domestic guinea pig(100731095) interleukin 13 receptor, alpha 1
naked mole-rat(101723721) interleukin 13 receptor, alpha 1
sheep(443518) interleukin 13 receptor, alpha 1
Zebrafish(799475) interleukin 13 receptor, alpha 1
cow(407110) interleukin 13 receptor, alpha 1
Horse(100055312) interleukin 13 receptor, alpha 1
chicken(422230) interleukin 13 receptor, alpha 1
dog(403623) interleukin 13 receptor, alpha 1
domestic cat(101091351) interleukin 13 receptor, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0681 Human IL13RA1 / Interleukin-13 Receptor Subunit Alpha-1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001560 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029151 MISSION® esiRNA esiRNA human IL13RA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001560 Rosetta Predictions human pricing
NM_145789 Rosetta Predictions rat pricing
NM_133990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041227 predicted 338
2 SASI_Hs01_00041228 predicted 1416
3 SASI_Hs01_00041229 predicted 1222
4 SASI_Hs01_00041230 predicted 1060
5 SASI_Hs01_00041231 predicted 603
6 SASI_Hs01_00041232 predicted 1067
7 SASI_Hs01_00041233 predicted 764
8 SASI_Hs01_00041234 predicted 952
9 SASI_Hs01_00041235 predicted 884
10 SASI_Hs01_00041236 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039659 predicted 834
2 SASI_Rn01_00039660 predicted 891
3 SASI_Rn01_00039662 predicted 507
4 SASI_Rn01_00039663 predicted 1361
5 SASI_Rn01_00039664 predicted 1072
6 SASI_Rn02_00268799 predicted 620
7 SASI_Rn01_00039665 predicted 1253
8 SASI_Rn01_00039666 predicted 1203
9 SASI_Rn01_00039667 predicted 809
10 SASI_Rn01_00039668 predicted 1370
11 SASI_Rn01_00039661 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196227 predicted 1035
2 SASI_Mm01_00196228 predicted 1365
3 SASI_Mm02_00339126 predicted 766
4 SASI_Mm02_00339127 predicted 887
5 SASI_Mm01_00196231 predicted 840
6 SASI_Mm02_00339128 predicted 1074
7 SASI_Mm01_00196232 predicted 363
8 SASI_Mm01_00196233 predicted 1248
9 SASI_Mm01_00196234 predicted 1202
10 SASI_Mm01_00196235 predicted 1370
11 SASI_Mm01_00196229 predicted 1406
12 SASI_Mm01_00196230 predicted 710
13 SASI_Mm01_00196236 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001560
VALIDATED
IL13RA1 MISSION shRNA Bacterial Glycerol Stock
interleukin 13 receptor, alpha 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-1036s21c1
Sequence:CCGGCCAAGAAATGAGTATAGGTAACTCGAGTTACCTATACTCATTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-215s21c1
Sequence:CCGGGCCAGCTCAAATTGTAGTCTACTCGAGTAGACTACAATTTGAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-1283s21c1
Sequence:CCGGGACTCTGTAGTGCTGATAGAACTCGAGTTCTATCAGCACTACAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-505s21c1
Sequence:CCGGCGACACTAACTATACTCTCTACTCGAGTAGAGAGTATAGTTAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-703s21c1
Sequence:CCGGGCCTTTAACTTCCCGTGTGAACTCGAGTTCACACGGGAAGTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-215s1c1
Sequence:CCGGGCCAGCTCAAATTGTAGTCTACTCGAGTAGACTACAATTTGAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-505s1c1
Sequence:CCGGCGACACTAACTATACTCTCTACTCGAGTAGAGAGTATAGTTAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-1283s1c1
Sequence:CCGGGACTCTGTAGTGCTGATAGAACTCGAGTTCTATCAGCACTACAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-1036s1c1
Sequence:CCGGCCAAGAAATGAGTATAGGTAACTCGAGTTACCTATACTCATTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-703s1c1
Sequence:CCGGGCCTTTAACTTCCCGTGTGAACTCGAGTTCACACGGGAAGTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001560
VALIDATED
IL13RA1 MISSION shRNA shRNA Plasmid DNA
interleukin 13 receptor, alpha 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-1036s21c1
Sequence:CCGGCCAAGAAATGAGTATAGGTAACTCGAGTTACCTATACTCATTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-215s21c1
Sequence:CCGGGCCAGCTCAAATTGTAGTCTACTCGAGTAGACTACAATTTGAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-1283s21c1
Sequence:CCGGGACTCTGTAGTGCTGATAGAACTCGAGTTCTATCAGCACTACAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-505s21c1
Sequence:CCGGCGACACTAACTATACTCTCTACTCGAGTAGAGAGTATAGTTAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-703s21c1
Sequence:CCGGGCCTTTAACTTCCCGTGTGAACTCGAGTTCACACGGGAAGTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-215s1c1
Sequence:CCGGGCCAGCTCAAATTGTAGTCTACTCGAGTAGACTACAATTTGAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-505s1c1
Sequence:CCGGCGACACTAACTATACTCTCTACTCGAGTAGAGAGTATAGTTAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-1283s1c1
Sequence:CCGGGACTCTGTAGTGCTGATAGAACTCGAGTTCTATCAGCACTACAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-1036s1c1
Sequence:CCGGCCAAGAAATGAGTATAGGTAACTCGAGTTACCTATACTCATTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-703s1c1
Sequence:CCGGGCCTTTAACTTCCCGTGTGAACTCGAGTTCACACGGGAAGTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001560
VALIDATED
IL13RA1 MISSION shRNA Lentiviral Transduction Particles
interleukin 13 receptor, alpha 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-1036s21c1
Sequence:CCGGCCAAGAAATGAGTATAGGTAACTCGAGTTACCTATACTCATTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-215s21c1
Sequence:CCGGGCCAGCTCAAATTGTAGTCTACTCGAGTAGACTACAATTTGAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-1283s21c1
Sequence:CCGGGACTCTGTAGTGCTGATAGAACTCGAGTTCTATCAGCACTACAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-505s21c1
Sequence:CCGGCGACACTAACTATACTCTCTACTCGAGTAGAGAGTATAGTTAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001560.2-703s21c1
Sequence:CCGGGCCTTTAACTTCCCGTGTGAACTCGAGTTCACACGGGAAGTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-215s1c1
Sequence:CCGGGCCAGCTCAAATTGTAGTCTACTCGAGTAGACTACAATTTGAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-505s1c1
Sequence:CCGGCGACACTAACTATACTCTCTACTCGAGTAGAGAGTATAGTTAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-1283s1c1
Sequence:CCGGGACTCTGTAGTGCTGATAGAACTCGAGTTCTATCAGCACTACAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-1036s1c1
Sequence:CCGGCCAAGAAATGAGTATAGGTAACTCGAGTTACCTATACTCATTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001560.2-703s1c1
Sequence:CCGGGCCTTTAACTTCCCGTGTGAACTCGAGTTCACACGGGAAGTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133990
IL13RA1 MISSION shRNA Bacterial Glycerol Stock
interleukin 13 receptor, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133990.3-2405s1c1
Sequence:CCGGGCCTGCAATTATTTGAGGTTTCTCGAGAAACCTCAAATAATTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-516s1c1
Sequence:CCGGCACACTATACTCTGTACTATTCTCGAGAATAGTACAGAGTATAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-442s1c1
Sequence:CCGGGCTCAAGTGCATTTGGCATAACTCGAGTTATGCCAAATGCACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-1237s1c1
Sequence:CCGGGCACTGGAAGAAGTATGACATCTCGAGATGTCATACTTCTTCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-734s1c1
Sequence:CCGGCCTCCACATATTAAACATCTTCTCGAGAAGATGTTTAATATGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133990
IL13RA1 MISSION shRNA shRNA Plasmid DNA
interleukin 13 receptor, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133990.3-2405s1c1
Sequence:CCGGGCCTGCAATTATTTGAGGTTTCTCGAGAAACCTCAAATAATTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-516s1c1
Sequence:CCGGCACACTATACTCTGTACTATTCTCGAGAATAGTACAGAGTATAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-442s1c1
Sequence:CCGGGCTCAAGTGCATTTGGCATAACTCGAGTTATGCCAAATGCACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-1237s1c1
Sequence:CCGGGCACTGGAAGAAGTATGACATCTCGAGATGTCATACTTCTTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-734s1c1
Sequence:CCGGCCTCCACATATTAAACATCTTCTCGAGAAGATGTTTAATATGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133990
IL13RA1 MISSION shRNA Lentiviral Transduction Particles
interleukin 13 receptor, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133990.3-2405s1c1
Sequence:CCGGGCCTGCAATTATTTGAGGTTTCTCGAGAAACCTCAAATAATTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-516s1c1
Sequence:CCGGCACACTATACTCTGTACTATTCTCGAGAATAGTACAGAGTATAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-442s1c1
Sequence:CCGGGCTCAAGTGCATTTGGCATAACTCGAGTTATGCCAAATGCACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-1237s1c1
Sequence:CCGGGCACTGGAAGAAGTATGACATCTCGAGATGTCATACTTCTTCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133990.3-734s1c1
Sequence:CCGGCCTCCACATATTAAACATCTTCTCGAGAAGATGTTTAATATGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)