EMAIL THIS PAGE TO A FRIEND

IL13RA2

interleukin 13 receptor, alpha 2

82 Gene Product Result for
Synonyms: CD213A2 CT19 IL-13R IL13BP
UniProtKB ID: Q14627, A8K7E2, O00667
Gene ID:
Human(3598) Summary: The protein encoded by this gene is closely related to Il13RA1, a subuint of the interleukin 13 receptor complex. This protein binds IL13 with high affinity, but lacks cytoplasmic domain, and does not appear to function as a signal mediator. It is reported to play a role in the internalization of IL13. [provided by RefSeq, Jul 2008]
Mouse(16165) interleukin 13 receptor, alpha 2
Rat(171060) interleukin 13 receptor, alpha 2
Zebrafish(368326) interleukin 13 receptor, alpha 2
domestic cat(101100114) interleukin 13 receptor, alpha 2
dog(403622) interleukin 13 receptor, alpha 2
chicken(422219) interleukin 13 receptor, alpha 2
sheep(101108025) interleukin 13 receptor, alpha 2
domestic guinea pig(100733400) interleukin 13 receptor, alpha 2
naked mole-rat(101725943) interleukin 13 receptor, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000640 Rosetta Predictions human pricing
NM_133538 Rosetta Predictions rat pricing
XM_579624 Rosetta Predictions rat pricing
NM_008356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156457 predicted 246
2 SASI_Hs01_00156458 predicted 545
3 SASI_Hs01_00156459 predicted 722
4 SASI_Hs01_00156460 predicted 736
5 SASI_Hs01_00156461 predicted 340
6 SASI_Hs01_00156464 predicted 214
7 SASI_Hs02_00302995 predicted 682
8 SASI_Hs01_00156465 predicted 526
9 SASI_Hs01_00156466 predicted 556
10 SASI_Hs02_00302996 predicted 1012
11 SASI_Hs01_00156462 predicted 611
12 SASI_Hs01_00156463 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074386 predicted 1351
2 SASI_Rn01_00074387 predicted 669
3 SASI_Rn01_00074388 predicted 1085
4 SASI_Rn01_00074389 predicted 1557
5 SASI_Rn01_00074390 predicted 741
6 SASI_Rn02_00267725 predicted 620
7 SASI_Rn01_00074391 predicted 1047
8 SASI_Rn01_00074392 predicted 1201
9 SASI_Rn01_00074393 predicted 856
10 SASI_Rn01_00074394 predicted 1206
11 SASI_Rn01_00074395 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186876 predicted 1136
2 SASI_Rn01_00186877 predicted 466
3 SASI_Rn01_00186878 predicted 879
4 SASI_Rn01_00186879 predicted 526
5 SASI_Rn01_00186880 predicted 842
6 SASI_Rn01_00186881 predicted 989
7 SASI_Rn01_00186882 predicted 653
8 SASI_Rn01_00186883 predicted 992
9 SASI_Rn01_00186884 predicted 1001
10 SASI_Rn01_00186885 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186165 predicted 862
2 SASI_Mm01_00186166 predicted 255
3 SASI_Mm01_00186167 predicted 548
4 SASI_Mm01_00186168 predicted 971
5 SASI_Mm01_00186169 predicted 416
6 SASI_Mm01_00186170 predicted 706
7 SASI_Mm01_00186171 predicted 320
8 SASI_Mm01_00186172 predicted 818
9 SASI_Mm01_00186173 predicted 351
10 SASI_Mm02_00313709 predicted 481
11 SASI_Mm01_00186174 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008356
IL13RA2 MISSION shRNA Bacterial Glycerol Stock
interleukin 13 receptor, alpha 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008356.1-1403s1c1
Sequence:CCGGCCACCAATTTCTTGACATAGACTCGAGTCTATGTCAAGAAATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008356.3-712s21c1
Sequence:CCGGATATTCTGATACCAACTATACCTCGAGGTATAGTTGGTATCAGAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-948s1c1
Sequence:CCGGGCCACCAGAATTCCTTCATATCTCGAGATATGAAGGAATTCTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-1030s1c1
Sequence:CCGGCCAAGGTGTTACACTTATGAACTCGAGTTCATAAGTGTAACACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-595s1c1
Sequence:CCGGCCATGGATAGAAGCTTCTTATCTCGAGATAAGAAGCTTCTATCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-784s1c1
Sequence:CCGGGCTGATTACCTCCAGCATGATCTCGAGATCATGCTGGAGGTAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008356.3-827s21c1
Sequence:CCGGTTGGACTCATCAGACTATAAACTCGAGTTTATAGTCTGATGAGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008356
IL13RA2 MISSION shRNA shRNA Plasmid DNA
interleukin 13 receptor, alpha 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008356.1-1403s1c1
Sequence:CCGGCCACCAATTTCTTGACATAGACTCGAGTCTATGTCAAGAAATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008356.3-712s21c1
Sequence:CCGGATATTCTGATACCAACTATACCTCGAGGTATAGTTGGTATCAGAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-948s1c1
Sequence:CCGGGCCACCAGAATTCCTTCATATCTCGAGATATGAAGGAATTCTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-1030s1c1
Sequence:CCGGCCAAGGTGTTACACTTATGAACTCGAGTTCATAAGTGTAACACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-595s1c1
Sequence:CCGGCCATGGATAGAAGCTTCTTATCTCGAGATAAGAAGCTTCTATCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-784s1c1
Sequence:CCGGGCTGATTACCTCCAGCATGATCTCGAGATCATGCTGGAGGTAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008356.3-827s21c1
Sequence:CCGGTTGGACTCATCAGACTATAAACTCGAGTTTATAGTCTGATGAGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008356
IL13RA2 MISSION shRNA Lentiviral Transduction Particles
interleukin 13 receptor, alpha 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008356.1-1403s1c1
Sequence:CCGGCCACCAATTTCTTGACATAGACTCGAGTCTATGTCAAGAAATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008356.3-712s21c1
Sequence:CCGGATATTCTGATACCAACTATACCTCGAGGTATAGTTGGTATCAGAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-948s1c1
Sequence:CCGGGCCACCAGAATTCCTTCATATCTCGAGATATGAAGGAATTCTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-1030s1c1
Sequence:CCGGCCAAGGTGTTACACTTATGAACTCGAGTTCATAAGTGTAACACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-595s1c1
Sequence:CCGGCCATGGATAGAAGCTTCTTATCTCGAGATAAGAAGCTTCTATCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008356.1-784s1c1
Sequence:CCGGGCTGATTACCTCCAGCATGATCTCGAGATCATGCTGGAGGTAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008356.3-827s21c1
Sequence:CCGGTTGGACTCATCAGACTATAAACTCGAGTTTATAGTCTGATGAGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000640
IL13RA2 MISSION shRNA Bacterial Glycerol Stock
interleukin 13 receptor, alpha 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-1029s1c1
Sequence:CCGGCGACAATTATGCTTTGTAGTACTCGAGTACTACAAAGCATAATTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-842s1c1
Sequence:CCGGGCCGCCAGTCTATCTTACTTTCTCGAGAAAGTAAGATAGACTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-490s1c1
Sequence:CCGGCCTGGGCAGAAACTACTTATTCTCGAGAATAAGTAGTTTCTGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-254s1c1
Sequence:CCGGCGGATACTTAGGTTATCTCTACTCGAGTAGAGATAACCTAAGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-1148s1c1
Sequence:CCGGGCTACGTTTCTGGCTACCATTCTCGAGAATGGTAGCCAGAAACGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-729s21c1
Sequence:CCGGTTGGAGGCATCAGACTATAAACTCGAGTTTATAGTCTGATGCCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-547s21c1
Sequence:CCGCAGGATATGGATTGCGTATATTCTCGAGAATATACGCAATCCATATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-788s21c1
Sequence:CCGGGCCTATCAGATCCAGTTATTTCTCGAGAAATAACTGGATCTGATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-901s21c1
Sequence:CCGGGCATACCTTTGGGACCTATTCCTCGAGGAATAGGTCCCAAAGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000640
IL13RA2 MISSION shRNA shRNA Plasmid DNA
interleukin 13 receptor, alpha 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-1029s1c1
Sequence:CCGGCGACAATTATGCTTTGTAGTACTCGAGTACTACAAAGCATAATTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-842s1c1
Sequence:CCGGGCCGCCAGTCTATCTTACTTTCTCGAGAAAGTAAGATAGACTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-490s1c1
Sequence:CCGGCCTGGGCAGAAACTACTTATTCTCGAGAATAAGTAGTTTCTGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-254s1c1
Sequence:CCGGCGGATACTTAGGTTATCTCTACTCGAGTAGAGATAACCTAAGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-1148s1c1
Sequence:CCGGGCTACGTTTCTGGCTACCATTCTCGAGAATGGTAGCCAGAAACGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-729s21c1
Sequence:CCGGTTGGAGGCATCAGACTATAAACTCGAGTTTATAGTCTGATGCCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-547s21c1
Sequence:CCGCAGGATATGGATTGCGTATATTCTCGAGAATATACGCAATCCATATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-788s21c1
Sequence:CCGGGCCTATCAGATCCAGTTATTTCTCGAGAAATAACTGGATCTGATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-901s21c1
Sequence:CCGGGCATACCTTTGGGACCTATTCCTCGAGGAATAGGTCCCAAAGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000640
IL13RA2 MISSION shRNA Lentiviral Transduction Particles
interleukin 13 receptor, alpha 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-1029s1c1
Sequence:CCGGCGACAATTATGCTTTGTAGTACTCGAGTACTACAAAGCATAATTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-842s1c1
Sequence:CCGGGCCGCCAGTCTATCTTACTTTCTCGAGAAAGTAAGATAGACTGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-490s1c1
Sequence:CCGGCCTGGGCAGAAACTACTTATTCTCGAGAATAAGTAGTTTCTGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-254s1c1
Sequence:CCGGCGGATACTTAGGTTATCTCTACTCGAGTAGAGATAACCTAAGTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000640.2-1148s1c1
Sequence:CCGGGCTACGTTTCTGGCTACCATTCTCGAGAATGGTAGCCAGAAACGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-729s21c1
Sequence:CCGGTTGGAGGCATCAGACTATAAACTCGAGTTTATAGTCTGATGCCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-547s21c1
Sequence:CCGCAGGATATGGATTGCGTATATTCTCGAGAATATACGCAATCCATATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-788s21c1
Sequence:CCGGGCCTATCAGATCCAGTTATTTCTCGAGAAATAACTGGATCTGATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000640.2-901s21c1
Sequence:CCGGGCATACCTTTGGGACCTATTCCTCGAGGAATAGGTCCCAAAGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)