EMAIL THIS PAGE TO A FRIEND

IL15

interleukin 15

144 Gene Product Result for
Synonyms: IL-15
Gene ID:
Human(3600) Summary: The protein encoded by this gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported. [provided by RefSeq, Feb 2011]
Mouse(16168) interleukin 15
Rat(25670) interleukin 15
naked mole-rat(101718208) interleukin 15
sheep(443056) interleukin 15
Zebrafish(654826) interleukin 15
cow(281248) interleukin 15
Horse(100034058) interleukin 15
chicken(395258) interleukin 15
dog(403584) interleukin 15
domestic cat(493682) interleukin 15
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301666 Anti-IL15 affinity isolated antibody human
immunohistochemistry pricing
SAB2502121 Anti-IL15 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2101148 Anti-IL15 antibody produced in rabbit affinity isolated antibody rat, mouse, bovine, pig, horse, dog, sheep, human
western blot pricing
HPA037738 Anti-IL15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0003600M1 Monoclonal Anti-IL15 antibody produced in mouse clone 1H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1400141 Monoclonal Anti-IL15 antibody produced in mouse clone 3A3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1400142 Monoclonal Anti-IL15 antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1400143 Monoclonal Anti-IL15 antibody produced in mouse clone 2H7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1400144 Monoclonal Anti-IL15 antibody produced in mouse clone 3E8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403977 Monoclonal Anti-IL15, (C-terminal) antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
I3532 Monoclonal Anti-Interleukin-15 antibody produced in mouse clone 34593.11, purified immunoglobulin, lyophilized powder human
neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000585 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000585 Rosetta Predictions human pricing
NM_172174 Rosetta Predictions human pricing
NM_013129 Rosetta Predictions rat pricing
NM_008357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302848 predicted 730
2 SASI_Hs01_00214518 predicted 564
3 SASI_Hs01_00214519 predicted 624
4 SASI_Hs01_00214520 predicted 888
5 SASI_Hs01_00214521 predicted 473
6 SASI_Hs01_00214522 predicted 578
7 SASI_Hs01_00214523 predicted 423
8 SASI_Hs01_00214524 predicted 515
9 SASI_Hs02_00302849 predicted 615
10 SASI_Hs01_00214526 predicted 653
11 SASI_Hs01_00214525 predicted 413
12 SASI_Hs01_00214527 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052567 predicted 1207
2 SASI_Hs01_00052568 predicted 1039
3 SASI_Hs01_00052569 predicted 1101
4 SASI_Hs01_00052570 predicted 1360
5 SASI_Hs01_00052571 predicted 946
6 SASI_Hs01_00052572 predicted 1047
7 SASI_Hs01_00052573 predicted 896
8 SASI_Hs01_00052574 predicted 986
9 SASI_Hs02_00367878 predicted 1084
10 SASI_Hs01_00052575 predicted 1125
11 SASI_Hs01_00052576 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260914 predicted 225
2 SASI_Rn02_00260915 predicted 260
3 SASI_Rn01_00033495 predicted 236
4 SASI_Rn02_00260916 predicted 263
5 SASI_Rn02_00260917 predicted 263
6 SASI_Rn02_00260918 predicted 194
7 SASI_Rn02_00260919 predicted 234
8 SASI_Rn02_00260920 predicted 213
9 SASI_Rn01_00033499 predicted 199
10 SASI_Rn02_00260921 predicted 225
11 SASI_Rn01_00033491 predicted 667
12 SASI_Rn01_00033492 predicted 912
13 SASI_Rn01_00033493 predicted 854
14 SASI_Rn01_00033494 predicted 729
15 SASI_Rn01_00033496 predicted 863
16 SASI_Rn01_00033497 predicted 727
17 SASI_Rn01_00033498 predicted 970
18 SASI_Rn01_00033500 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053590 predicted 581
2 SASI_Mm01_00053591 predicted 605
3 SASI_Mm02_00313710 predicted 706
4 SASI_Mm01_00053592 predicted 769
5 SASI_Mm01_00053593 predicted 676
6 SASI_Mm01_00053594 predicted 650
7 SASI_Mm01_00053595 predicted 641
8 SASI_Mm01_00053596 predicted 663
9 SASI_Mm01_00053597 predicted 778
10 SASI_Mm01_00053598 predicted 691
11 SASI_Mm01_00053599 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008357
IL15 MISSION shRNA Bacterial Glycerol Stock
interleukin 15
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008357.1-1079s21c1
Sequence:CCGGGCCACTTGGATCACATGAAATCTCGAGATTTCATGTGATCCAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008357.1-702s21c1
Sequence:CCGGTCATCCCAGTTGCAAAGTTACCTCGAGGTAACTTTGCAACTGGGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008357.1-1056s1c1
Sequence:CCGGGCTTCCTAACAAGGAGATAATCTCGAGATTATCTCCTTGTTAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-768s1c1
Sequence:CCGGGTACAGTAACATGACTCTTAACTCGAGTTAAGAGTCATGTTACTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-509s1c1
Sequence:CCGGGCTACTTGTGTTTCCTTCTAACTCGAGTTAGAAGGAAACACAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-550s1c1
Sequence:CCGGGCTGGCATTCATGTCTTCATTCTCGAGAATGAAGACATGAATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-608s1c1
Sequence:CCGGCCAACTGGATAGATGTAAGATCTCGAGATCTTACATCTATCCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008357
IL15 MISSION shRNA shRNA Plasmid DNA
interleukin 15
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008357.1-1079s21c1
Sequence:CCGGGCCACTTGGATCACATGAAATCTCGAGATTTCATGTGATCCAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008357.1-702s21c1
Sequence:CCGGTCATCCCAGTTGCAAAGTTACCTCGAGGTAACTTTGCAACTGGGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008357.1-1056s1c1
Sequence:CCGGGCTTCCTAACAAGGAGATAATCTCGAGATTATCTCCTTGTTAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-768s1c1
Sequence:CCGGGTACAGTAACATGACTCTTAACTCGAGTTAAGAGTCATGTTACTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-509s1c1
Sequence:CCGGGCTACTTGTGTTTCCTTCTAACTCGAGTTAGAAGGAAACACAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-550s1c1
Sequence:CCGGGCTGGCATTCATGTCTTCATTCTCGAGAATGAAGACATGAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-608s1c1
Sequence:CCGGCCAACTGGATAGATGTAAGATCTCGAGATCTTACATCTATCCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008357
IL15 MISSION shRNA Lentiviral Transduction Particles
interleukin 15
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008357.1-1079s21c1
Sequence:CCGGGCCACTTGGATCACATGAAATCTCGAGATTTCATGTGATCCAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008357.1-702s21c1
Sequence:CCGGTCATCCCAGTTGCAAAGTTACCTCGAGGTAACTTTGCAACTGGGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008357.1-1056s1c1
Sequence:CCGGGCTTCCTAACAAGGAGATAATCTCGAGATTATCTCCTTGTTAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-768s1c1
Sequence:CCGGGTACAGTAACATGACTCTTAACTCGAGTTAAGAGTCATGTTACTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-509s1c1
Sequence:CCGGGCTACTTGTGTTTCCTTCTAACTCGAGTTAGAAGGAAACACAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-550s1c1
Sequence:CCGGGCTGGCATTCATGTCTTCATTCTCGAGAATGAAGACATGAATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008357.1-608s1c1
Sequence:CCGGCCAACTGGATAGATGTAAGATCTCGAGATCTTACATCTATCCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000585
IL15 MISSION shRNA Bacterial Glycerol Stock
interleukin 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000585.3-903s21c1
Sequence:CCGGCACTCTGCTGCTTAGACATAACTCGAGTTATGTCTAAGCAGCAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000585.3-643s21c1
Sequence:CCGGCTCTTGGAGTTACAAGTTATTCTCGAGAATAACTTGTAACTCCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000585.3-1208s21c1
Sequence:CCGGTAAGGGTGATAGTCAAATTATCTCGAGATAATTTGACTATCACCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-520s1c1
Sequence:CCGGTGGGTGAATGTAATAAGTGATCTCGAGATCACTTATTACATTCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-737s1c1
Sequence:CCGGTGTCTTCTAATGGGAATGTAACTCGAGTTACATTCCCATTAGAAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-412s1c1
Sequence:CCGGCAGTGCTACTTGTGTTTACTTCTCGAGAAGTAAACACAAGTAGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-685s1c1
Sequence:CCGGGCAAGTATTCATGATACAGTACTCGAGTACTGTATCATGAATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000585.3-550s21c1
Sequence:CCGGGAAGATCTTATTCAATCTATGCTCGAGCATAGATTGAATAAGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000585
IL15 MISSION shRNA shRNA Plasmid DNA
interleukin 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000585.3-903s21c1
Sequence:CCGGCACTCTGCTGCTTAGACATAACTCGAGTTATGTCTAAGCAGCAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000585.3-643s21c1
Sequence:CCGGCTCTTGGAGTTACAAGTTATTCTCGAGAATAACTTGTAACTCCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000585.3-1208s21c1
Sequence:CCGGTAAGGGTGATAGTCAAATTATCTCGAGATAATTTGACTATCACCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-520s1c1
Sequence:CCGGTGGGTGAATGTAATAAGTGATCTCGAGATCACTTATTACATTCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-737s1c1
Sequence:CCGGTGTCTTCTAATGGGAATGTAACTCGAGTTACATTCCCATTAGAAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-412s1c1
Sequence:CCGGCAGTGCTACTTGTGTTTACTTCTCGAGAAGTAAACACAAGTAGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-685s1c1
Sequence:CCGGGCAAGTATTCATGATACAGTACTCGAGTACTGTATCATGAATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000585.3-550s21c1
Sequence:CCGGGAAGATCTTATTCAATCTATGCTCGAGCATAGATTGAATAAGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000585
IL15 MISSION shRNA Lentiviral Transduction Particles
interleukin 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000585.3-903s21c1
Sequence:CCGGCACTCTGCTGCTTAGACATAACTCGAGTTATGTCTAAGCAGCAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000585.3-643s21c1
Sequence:CCGGCTCTTGGAGTTACAAGTTATTCTCGAGAATAACTTGTAACTCCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000585.3-1208s21c1
Sequence:CCGGTAAGGGTGATAGTCAAATTATCTCGAGATAATTTGACTATCACCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-520s1c1
Sequence:CCGGTGGGTGAATGTAATAAGTGATCTCGAGATCACTTATTACATTCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-737s1c1
Sequence:CCGGTGTCTTCTAATGGGAATGTAACTCGAGTTACATTCCCATTAGAAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-412s1c1
Sequence:CCGGCAGTGCTACTTGTGTTTACTTCTCGAGAAGTAAACACAAGTAGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000585.2-685s1c1
Sequence:CCGGGCAAGTATTCATGATACAGTACTCGAGTACTGTATCATGAATACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000585.3-550s21c1
Sequence:CCGGGAAGATCTTATTCAATCTATGCTCGAGCATAGATTGAATAAGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)