EMAIL THIS PAGE TO A FRIEND

IL15RA

interleukin 15 receptor, alpha

90 Gene Product Result for
Synonyms: CD215
Gene ID:
Human(3601) Summary: This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]
Mouse(16169) interleukin 15 receptor, alpha chain
Rat(690369) interleukin 15 receptor, alpha
chicken(416686) interleukin 15 receptor, alpha
dog(487141) interleukin 15 receptor, alpha
cow(615030) interleukin 15 receptor, alpha
sheep(101107377) interleukin 15 receptor, alpha
domestic guinea pig(100379546) interleukin 15 receptor, alpha chain
naked mole-rat(101721276) interleukin 15 receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002189 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089841 MISSION® esiRNA esiRNA human IL15RA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002189 Rosetta Predictions human pricing
NM_172200 Rosetta Predictions human pricing
NM_008358 Rosetta Predictions mouse pricing
NM_133836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333407 predicted 919
2 SASI_Hs01_00154481 predicted 617
3 SASI_Hs01_00154482 predicted 902
4 SASI_Hs01_00154483 predicted 787
5 SASI_Hs01_00154484 predicted 560
6 SASI_Hs01_00154485 predicted 1241
7 SASI_Hs01_00154486 predicted 1260
8 SASI_Hs01_00154488 predicted 563
9 SASI_Hs01_00154489 predicted 803
10 SASI_Hs01_00154490 predicted 1172
11 SASI_Hs01_00154487 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367902 predicted 1155
2 SASI_Hs02_00367903 predicted 1402
3 SASI_Hs01_00147222 predicted 849
4 SASI_Hs01_00147223 predicted 1136
5 SASI_Hs01_00147224 predicted 1023
6 SASI_Hs01_00147225 predicted 798
7 SASI_Hs01_00147226 predicted 1475
8 SASI_Hs01_00147227 predicted 1492
9 SASI_Hs01_00147229 predicted 797
10 SASI_Hs01_00147230 predicted 1040
11 SASI_Hs01_00147228 predicted 1468
12 SASI_Hs01_00147231 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088076 predicted 464
2 SASI_Mm01_00088077 predicted 322
3 SASI_Mm01_00088078 predicted 298
4 SASI_Mm01_00088079 predicted 328
5 SASI_Mm01_00088080 predicted 414
6 SASI_Mm01_00088081 predicted 333
7 SASI_Mm01_00088082 predicted 416
8 SASI_Mm01_00088083 predicted 463
9 SASI_Mm01_00088084 predicted 475
10 SASI_Mm02_00313711 predicted 317
11 SASI_Mm01_00088085 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028153 predicted 513
2 SASI_Mm01_00028154 predicted 499
3 SASI_Mm01_00028155 predicted 411
4 SASI_Mm01_00028156 predicted 501
5 SASI_Mm01_00028157 predicted 506
6 SASI_Mm01_00028158 predicted 362
7 SASI_Mm01_00028159 predicted 432
8 SASI_Mm01_00028160 predicted 410
9 SASI_Mm01_00028161 predicted 425
10 SASI_Mm01_00028162 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133836
IL15RA MISSION shRNA Bacterial Glycerol Stock
interleukin 15 receptor, alpha
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133836.1-931s1c1
Sequence:CCGGCCACCTTTCTTCCTGGTTCATCTCGAGATGAACCAGGAAGAAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-515s1c1
Sequence:CCGGCCCTCAGGATAACAGAGATTTCTCGAGAAATCTCTGTTATCCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-567s1c1
Sequence:CCGGCATCTCTACATCGGTCCTCTTCTCGAGAAGAGGACCGATGTAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-653s1c1
Sequence:CCGGCGTGCCGTGTTGAGGTGGAAACTCGAGTTTCCACCTCAACACGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-398s1c1
Sequence:CCGGCCAGGCTGACACCATCCCAAACTCGAGTTTGGGATGGTGTCAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133836.1-1194s21c1
Sequence:CCGGCTTTGCTGCTTTGCACCTATTCTCGAGAATAGGTGCAAAGCAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133836.1-831s21c1
Sequence:CCGGGAAAGCCCAATGTGATAATAGCTCGAGCTATTATCACATTGGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133836
IL15RA MISSION shRNA shRNA Plasmid DNA
interleukin 15 receptor, alpha
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133836.1-931s1c1
Sequence:CCGGCCACCTTTCTTCCTGGTTCATCTCGAGATGAACCAGGAAGAAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-515s1c1
Sequence:CCGGCCCTCAGGATAACAGAGATTTCTCGAGAAATCTCTGTTATCCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-567s1c1
Sequence:CCGGCATCTCTACATCGGTCCTCTTCTCGAGAAGAGGACCGATGTAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-653s1c1
Sequence:CCGGCGTGCCGTGTTGAGGTGGAAACTCGAGTTTCCACCTCAACACGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-398s1c1
Sequence:CCGGCCAGGCTGACACCATCCCAAACTCGAGTTTGGGATGGTGTCAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133836.1-1194s21c1
Sequence:CCGGCTTTGCTGCTTTGCACCTATTCTCGAGAATAGGTGCAAAGCAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133836.1-831s21c1
Sequence:CCGGGAAAGCCCAATGTGATAATAGCTCGAGCTATTATCACATTGGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133836
IL15RA MISSION shRNA Lentiviral Transduction Particles
interleukin 15 receptor, alpha
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133836.1-931s1c1
Sequence:CCGGCCACCTTTCTTCCTGGTTCATCTCGAGATGAACCAGGAAGAAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-515s1c1
Sequence:CCGGCCCTCAGGATAACAGAGATTTCTCGAGAAATCTCTGTTATCCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-567s1c1
Sequence:CCGGCATCTCTACATCGGTCCTCTTCTCGAGAAGAGGACCGATGTAGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-653s1c1
Sequence:CCGGCGTGCCGTGTTGAGGTGGAAACTCGAGTTTCCACCTCAACACGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133836.1-398s1c1
Sequence:CCGGCCAGGCTGACACCATCCCAAACTCGAGTTTGGGATGGTGTCAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133836.1-1194s21c1
Sequence:CCGGCTTTGCTGCTTTGCACCTATTCTCGAGAATAGGTGCAAAGCAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133836.1-831s21c1
Sequence:CCGGGAAAGCCCAATGTGATAATAGCTCGAGCTATTATCACATTGGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002189
VALIDATED
IL15RA MISSION shRNA Bacterial Glycerol Stock
interleukin 15 receptor, alpha
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-250s1c1
Sequence:CCGGGTACATTTGTAACTCTGGTTTCTCGAGAAACCAGAGTTACAAATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002189.2-759s1c1
Sequence:CCGGGCTACCTCAAGTCAAGGCAAACTCGAGTTTGCCTTGACTTGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-793s1c1
Sequence:CCGGCAGCGTTGAAATGGAAGCCATCTCGAGATGGCTTCCATTTCAACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-500s1c1
Sequence:CCGGGCGGCCACAACAGCAGCTATTCTCGAGAATAGCTGCTGTTGTGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002189.2-204s21c1
Sequence:CCGGACGCAGACATCTGGGTCAAGACTCGAGTCTTGACCCAGATGTCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002189.2-926s21c1
Sequence:CCGGAGCCTCTCTGCTTTAGCTAAACTCGAGTTTAGCTAAAGCAGAGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002189
VALIDATED
IL15RA MISSION shRNA shRNA Plasmid DNA
interleukin 15 receptor, alpha
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-250s1c1
Sequence:CCGGGTACATTTGTAACTCTGGTTTCTCGAGAAACCAGAGTTACAAATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002189.2-759s1c1
Sequence:CCGGGCTACCTCAAGTCAAGGCAAACTCGAGTTTGCCTTGACTTGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-793s1c1
Sequence:CCGGCAGCGTTGAAATGGAAGCCATCTCGAGATGGCTTCCATTTCAACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-500s1c1
Sequence:CCGGGCGGCCACAACAGCAGCTATTCTCGAGAATAGCTGCTGTTGTGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002189.2-204s21c1
Sequence:CCGGACGCAGACATCTGGGTCAAGACTCGAGTCTTGACCCAGATGTCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002189.2-926s21c1
Sequence:CCGGAGCCTCTCTGCTTTAGCTAAACTCGAGTTTAGCTAAAGCAGAGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002189
VALIDATED
IL15RA MISSION shRNA Lentiviral Transduction Particles
interleukin 15 receptor, alpha
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-250s1c1
Sequence:CCGGGTACATTTGTAACTCTGGTTTCTCGAGAAACCAGAGTTACAAATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002189.2-759s1c1
Sequence:CCGGGCTACCTCAAGTCAAGGCAAACTCGAGTTTGCCTTGACTTGAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-793s1c1
Sequence:CCGGCAGCGTTGAAATGGAAGCCATCTCGAGATGGCTTCCATTTCAACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002189.2-500s1c1
Sequence:CCGGGCGGCCACAACAGCAGCTATTCTCGAGAATAGCTGCTGTTGTGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002189.2-204s21c1
Sequence:CCGGACGCAGACATCTGGGTCAAGACTCGAGTCTTGACCCAGATGTCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002189.2-926s21c1
Sequence:CCGGAGCCTCTCTGCTTTAGCTAAACTCGAGTTTAGCTAAAGCAGAGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)