EMAIL THIS PAGE TO A FRIEND

IL17B

interleukin 17B

64 Gene Product Result for
Synonyms: IL-17B IL-20 NIRF ZCYTO7
UniProtKB ID: Q9UHF5, Q14CE5
Gene ID:
Human(27190) Summary: The protein encoded by this gene is a T cell-derived cytokine that shares sequence similarity with IL17. This cytokine was reported to stimulate the release of TNF alpha (TNF) and IL1 beta (IL1B) from a monocytic cell line. Immunohistochemical analysis of several nerve tissues indicated that this cytokine is primarily localized to neuronal cell bodies. [provided by RefSeq, Jul 2008]
Mouse(56069) interleukin 17B
Rat(116472) interleukin 17B
chicken(427620) interleukin 17B
domestic cat(101086204) interleukin 17B
cow(504992) interleukin 17B
dog(489193) interleukin 17B
naked mole-rat(101714537) interleukin 17B
sheep(101119984) interleukin 17B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005961 MISSION® esiRNA esiRNA targeting mouse Il17b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014443 Rosetta Predictions human pricing
XM_001062716 Rosetta Predictions rat pricing
XM_341621 Rosetta Predictions rat pricing
NM_019508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109345 predicted 403
2 SASI_Hs02_00345649 predicted 210
3 SASI_Hs01_00109346 predicted 210
4 SASI_Hs01_00109347 predicted 292
5 SASI_Hs01_00109348 predicted 220
6 SASI_Hs02_00345650 predicted 288
7 SASI_Hs01_00109350 predicted 213
8 SASI_Hs01_00109351 predicted 467
9 SASI_Hs01_00109352 predicted 284
10 SASI_Hs01_00109353 predicted 278
11 SASI_Hs01_00109349 predicted 265
12 SASI_Hs01_00109354 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304362 predicted 196
2 SASI_Rn02_00304363 predicted 389
3 SASI_Rn02_00304364 predicted 393
4 SASI_Rn02_00304365 predicted 458
5 SASI_Rn02_00304366 predicted 203
6 SASI_Rn02_00304367 predicted 397
7 SASI_Rn02_00304368 predicted 345
8 SASI_Rn02_00304369 predicted 360
9 SASI_Rn02_00304370 predicted 447
10 SASI_Rn02_00304371 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393139 predicted 198
2 SASI_Rn02_00393140 predicted 389
3 SASI_Rn02_00393141 predicted 395
4 SASI_Rn02_00393142 predicted 453
5 SASI_Rn02_00393143 predicted 205
6 SASI_Rn02_00393144 predicted 399
7 SASI_Rn02_00393145 predicted 336
8 SASI_Rn02_00393146 predicted 363
9 SASI_Rn02_00393147 predicted 447
10 SASI_Rn02_00393148 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177754 predicted 412
2 SASI_Mm01_00177755 predicted 391
3 SASI_Mm01_00177756 predicted 210
4 SASI_Mm01_00177757 predicted 398
5 SASI_Mm01_00177758 predicted 216
6 SASI_Mm01_00177759 predicted 288
7 SASI_Mm01_00177760 predicted 350
8 SASI_Mm01_00177761 predicted 467
9 SASI_Mm01_00177762 predicted 194
10 SASI_Mm01_00177763 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014443
IL17B MISSION shRNA Bacterial Glycerol Stock
interleukin 17B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-216s21c1
Sequence:CCGGTATGCCCGCATGGAGGAGTATCTCGAGATACTCCTCCATGCGGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-236s21c1
Sequence:CCGGTGAGAGGAACATCGAGGAGATCTCGAGATCTCCTCGATGTTCCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-306s21c1
Sequence:CCGGGTCAACTTGCAGCTGTGGATGCTCGAGCATCCACAGCTGCAAGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-190s21c1
Sequence:CCGGTGGACCTGGTGTCACGGATGACTCGAGTCATCCGTGACACCAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-545s1c1
Sequence:CCGGGCGCGCAGTCATGGAGACCATCTCGAGATGGTCTCCATGACTGCGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-290s1c1
Sequence:CCGGCCAGAGAAAGTGTGAGGTCAACTCGAGTTGACCTCACACTTTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-198s1c1
Sequence:CCGGGTGTCACGGATGAAACCGTATCTCGAGATACGGTTTCATCCGTGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-80s1c1
Sequence:CCGGTCTTACCATTTCCATCTTCCTCTCGAGAGGAAGATGGAAATGGTAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-314s1c1
Sequence:CCGGGCAGCTGTGGATGTCCAACAACTCGAGTTGTTGGACATCCACAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014443
IL17B MISSION shRNA shRNA Plasmid DNA
interleukin 17B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-216s21c1
Sequence:CCGGTATGCCCGCATGGAGGAGTATCTCGAGATACTCCTCCATGCGGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-236s21c1
Sequence:CCGGTGAGAGGAACATCGAGGAGATCTCGAGATCTCCTCGATGTTCCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-306s21c1
Sequence:CCGGGTCAACTTGCAGCTGTGGATGCTCGAGCATCCACAGCTGCAAGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-190s21c1
Sequence:CCGGTGGACCTGGTGTCACGGATGACTCGAGTCATCCGTGACACCAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-545s1c1
Sequence:CCGGGCGCGCAGTCATGGAGACCATCTCGAGATGGTCTCCATGACTGCGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-290s1c1
Sequence:CCGGCCAGAGAAAGTGTGAGGTCAACTCGAGTTGACCTCACACTTTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-198s1c1
Sequence:CCGGGTGTCACGGATGAAACCGTATCTCGAGATACGGTTTCATCCGTGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-80s1c1
Sequence:CCGGTCTTACCATTTCCATCTTCCTCTCGAGAGGAAGATGGAAATGGTAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-314s1c1
Sequence:CCGGGCAGCTGTGGATGTCCAACAACTCGAGTTGTTGGACATCCACAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014443
IL17B MISSION shRNA Lentiviral Transduction Particles
interleukin 17B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-216s21c1
Sequence:CCGGTATGCCCGCATGGAGGAGTATCTCGAGATACTCCTCCATGCGGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-236s21c1
Sequence:CCGGTGAGAGGAACATCGAGGAGATCTCGAGATCTCCTCGATGTTCCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-306s21c1
Sequence:CCGGGTCAACTTGCAGCTGTGGATGCTCGAGCATCCACAGCTGCAAGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014443.2-190s21c1
Sequence:CCGGTGGACCTGGTGTCACGGATGACTCGAGTCATCCGTGACACCAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-545s1c1
Sequence:CCGGGCGCGCAGTCATGGAGACCATCTCGAGATGGTCTCCATGACTGCGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-290s1c1
Sequence:CCGGCCAGAGAAAGTGTGAGGTCAACTCGAGTTGACCTCACACTTTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-198s1c1
Sequence:CCGGGTGTCACGGATGAAACCGTATCTCGAGATACGGTTTCATCCGTGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-80s1c1
Sequence:CCGGTCTTACCATTTCCATCTTCCTCTCGAGAGGAAGATGGAAATGGTAAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014443.2-314s1c1
Sequence:CCGGGCAGCTGTGGATGTCCAACAACTCGAGTTGTTGGACATCCACAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019508
IL17B MISSION shRNA Bacterial Glycerol Stock
interleukin 17B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000066758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-284s1c1
Sequence:CCGGCCAGCCAAGAAGAAATGTGAACTCGAGTTCACATTTCTTCTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-227s1c1
Sequence:CCGGGAAGAGTATGAGCGGAACCTTCTCGAGAAGGTTCCGCTCATACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-405s1c1
Sequence:CCGGCGCGGTGCCTATGTTTGGGTTCTCGAGAACCCAAACATAGGCACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-214s1c1
Sequence:CCGGCTACGCTCGAATGGAAGAGTACTCGAGTACTCTTCCATTCGAGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019508
IL17B MISSION shRNA shRNA Plasmid DNA
interleukin 17B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000066758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-284s1c1
Sequence:CCGGCCAGCCAAGAAGAAATGTGAACTCGAGTTCACATTTCTTCTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-227s1c1
Sequence:CCGGGAAGAGTATGAGCGGAACCTTCTCGAGAAGGTTCCGCTCATACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-405s1c1
Sequence:CCGGCGCGGTGCCTATGTTTGGGTTCTCGAGAACCCAAACATAGGCACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-214s1c1
Sequence:CCGGCTACGCTCGAATGGAAGAGTACTCGAGTACTCTTCCATTCGAGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019508
IL17B MISSION shRNA Lentiviral Transduction Particles
interleukin 17B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000066758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-284s1c1
Sequence:CCGGCCAGCCAAGAAGAAATGTGAACTCGAGTTCACATTTCTTCTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-227s1c1
Sequence:CCGGGAAGAGTATGAGCGGAACCTTCTCGAGAAGGTTCCGCTCATACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-405s1c1
Sequence:CCGGCGCGGTGCCTATGTTTGGGTTCTCGAGAACCCAAACATAGGCACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019508.1-214s1c1
Sequence:CCGGCTACGCTCGAATGGAAGAGTACTCGAGTACTCTTCCATTCGAGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)