EMAIL THIS PAGE TO A FRIEND

IL17C

interleukin 17C

57 Gene Product Result for
Synonyms: CX2 IL-17C IL-21
UniProtKB ID: Q9P0M4, Q3MIG8, Q9HC75
Gene ID:
Human(27189) Summary: The protein encoded by this gene is a T cell-derived cytokine that shares the sequence similarity with IL17. This cytokine was reported to stimulate the release of tumor necrosis factor alpha and interleukin 1 beta from a monocytic cell line. The expression of this cytokine was found to be restricted to activated T cells. [provided by RefSeq, Jul 2008]
Mouse(234836) interleukin 17C
Rat(691516) interleukin 17C
sheep(101107039) interleukin 17C
naked mole-rat(101710295) interleukin 17C
Zebrafish(553960) interleukin 17c
chicken(100859040) interleukin 17C
domestic cat(101097443) interleukin 17C
dog(608988) interleukin 17C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013278 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172981 MISSION® esiRNA esiRNA targeting mouse Il17c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013278 Rosetta Predictions human pricing
XM_001078615 Rosetta Predictions rat pricing
NM_145834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038080 predicted 376
2 SASI_Hs01_00038081 predicted 469
3 SASI_Hs01_00038082 predicted 281
4 SASI_Hs02_00344528 predicted 468
5 SASI_Hs01_00038085 predicted 383
6 SASI_Hs01_00038086 predicted 482
7 SASI_Hs02_00344529 predicted 274
8 SASI_Hs02_00344530 predicted 478
9 SASI_Hs01_00038087 predicted 338
10 SASI_Hs02_00344531 predicted 283
11 SASI_Hs01_00038079 predicted 578
12 SASI_Hs01_00038083 predicted 401
13 SASI_Hs01_00038084 predicted 627
14 SASI_Hs01_00038088 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361457 predicted 335
2 SASI_Rn02_00361458 predicted 245
3 SASI_Rn02_00361459 predicted 379
4 SASI_Rn02_00361460 predicted 254
5 SASI_Rn02_00361461 predicted 343
6 SASI_Rn02_00361462 predicted 248
7 SASI_Rn02_00361463 predicted 341
8 SASI_Rn02_00361464 predicted 382
9 SASI_Rn02_00361465 predicted 384
10 SASI_Rn02_00361466 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166622 predicted 309
2 SASI_Mm01_00166623 predicted 218
3 SASI_Mm02_00341302 predicted 364
4 SASI_Mm02_00341303 predicted 378
5 SASI_Mm02_00341304 predicted 402
6 SASI_Mm02_00341305 predicted 394
7 SASI_Mm02_00341306 predicted 362
8 SASI_Mm01_00166627 predicted 224
9 SASI_Mm01_00166628 predicted 307
10 SASI_Mm02_00341307 predicted 366
11 SASI_Mm01_00166621 predicted 368
12 SASI_Mm01_00166624 predicted 319
13 SASI_Mm01_00166625 predicted 226
14 SASI_Mm01_00166626 predicted 293
15 SASI_Mm01_00166629 predicted 364
16 SASI_Mm01_00166630 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145834
IL17C MISSION shRNA Bacterial Glycerol Stock
interleukin 17C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-28s1c1
Sequence:CCGGCCTACTGGGATGACCCACCAACTCGAGTTGGTGGGTCATCCCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-306s1c1
Sequence:CCGGCTCACCATGGAGATATCGCATCTCGAGATGCGATATCTCCATGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-367s1c1
Sequence:CCGGGCAGAATGCTTGTGTCGTGGACTCGAGTCCACGACACAAGCATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-321s1c1
Sequence:CCGGTCGCATCGACACAGATGAGAACTCGAGTTCTCATCTGTGTCGATGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-95s1c1
Sequence:CCGGGCTACTCTGCTGAGGAATTATCTCGAGATAATTCCTCAGCAGAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145834
IL17C MISSION shRNA shRNA Plasmid DNA
interleukin 17C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-28s1c1
Sequence:CCGGCCTACTGGGATGACCCACCAACTCGAGTTGGTGGGTCATCCCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-306s1c1
Sequence:CCGGCTCACCATGGAGATATCGCATCTCGAGATGCGATATCTCCATGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-367s1c1
Sequence:CCGGGCAGAATGCTTGTGTCGTGGACTCGAGTCCACGACACAAGCATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-321s1c1
Sequence:CCGGTCGCATCGACACAGATGAGAACTCGAGTTCTCATCTGTGTCGATGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-95s1c1
Sequence:CCGGGCTACTCTGCTGAGGAATTATCTCGAGATAATTCCTCAGCAGAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145834
IL17C MISSION shRNA Lentiviral Transduction Particles
interleukin 17C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-28s1c1
Sequence:CCGGCCTACTGGGATGACCCACCAACTCGAGTTGGTGGGTCATCCCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-306s1c1
Sequence:CCGGCTCACCATGGAGATATCGCATCTCGAGATGCGATATCTCCATGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-367s1c1
Sequence:CCGGGCAGAATGCTTGTGTCGTGGACTCGAGTCCACGACACAAGCATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-321s1c1
Sequence:CCGGTCGCATCGACACAGATGAGAACTCGAGTTCTCATCTGTGTCGATGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145834.1-95s1c1
Sequence:CCGGGCTACTCTGCTGAGGAATTATCTCGAGATAATTCCTCAGCAGAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013278
IL17C MISSION shRNA Bacterial Glycerol Stock
interleukin 17C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-389s1c1
Sequence:CCGGGACACGGATGAGGACCGCTATCTCGAGATAGCGGTCCTCATCCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-436s1c1
Sequence:CCGGCCTGTGCAGAGGCTGTATCGACTCGAGTCGATACAGCCTCTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-583s1c1
Sequence:CCGGCCACACCGAGTTCATCCACGTCTCGAGACGTGGATGAACTCGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-148s1c1
Sequence:CCGGCCCACACTGCTACTCGGCTGACTCGAGTCAGCCGAGTAGCAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-574s1c1
Sequence:CCGGCTTTGCCTTCCACACCGAGTTCTCGAGAACTCGGTGTGGAAGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013278.3-839s21c1
Sequence:CCGGGCACCTCTTCCAGCCCTTAAACTCGAGTTTAAGGGCTGGAAGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013278.3-802s21c1
Sequence:CCGGATCTCCAGCCTCAGTAGTTGGCTCGAGCCAACTACTGAGGCTGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013278.3-368s21c1
Sequence:CCGGTCACCCTGGAGATACCGTGTGCTCGAGCACACGGTATCTCCAGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013278.3-406s21c1
Sequence:CCGGCTATCCACAGAAGCTGGCCTTCTCGAGAAGGCCAGCTTCTGTGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013278
IL17C MISSION shRNA shRNA Plasmid DNA
interleukin 17C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-389s1c1
Sequence:CCGGGACACGGATGAGGACCGCTATCTCGAGATAGCGGTCCTCATCCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-436s1c1
Sequence:CCGGCCTGTGCAGAGGCTGTATCGACTCGAGTCGATACAGCCTCTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-583s1c1
Sequence:CCGGCCACACCGAGTTCATCCACGTCTCGAGACGTGGATGAACTCGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-148s1c1
Sequence:CCGGCCCACACTGCTACTCGGCTGACTCGAGTCAGCCGAGTAGCAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-574s1c1
Sequence:CCGGCTTTGCCTTCCACACCGAGTTCTCGAGAACTCGGTGTGGAAGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013278.3-839s21c1
Sequence:CCGGGCACCTCTTCCAGCCCTTAAACTCGAGTTTAAGGGCTGGAAGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013278.3-802s21c1
Sequence:CCGGATCTCCAGCCTCAGTAGTTGGCTCGAGCCAACTACTGAGGCTGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013278.3-368s21c1
Sequence:CCGGTCACCCTGGAGATACCGTGTGCTCGAGCACACGGTATCTCCAGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013278.3-406s21c1
Sequence:CCGGCTATCCACAGAAGCTGGCCTTCTCGAGAAGGCCAGCTTCTGTGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013278
IL17C MISSION shRNA Lentiviral Transduction Particles
interleukin 17C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-389s1c1
Sequence:CCGGGACACGGATGAGGACCGCTATCTCGAGATAGCGGTCCTCATCCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-436s1c1
Sequence:CCGGCCTGTGCAGAGGCTGTATCGACTCGAGTCGATACAGCCTCTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-583s1c1
Sequence:CCGGCCACACCGAGTTCATCCACGTCTCGAGACGTGGATGAACTCGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-148s1c1
Sequence:CCGGCCCACACTGCTACTCGGCTGACTCGAGTCAGCCGAGTAGCAGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013278.3-574s1c1
Sequence:CCGGCTTTGCCTTCCACACCGAGTTCTCGAGAACTCGGTGTGGAAGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013278.3-839s21c1
Sequence:CCGGGCACCTCTTCCAGCCCTTAAACTCGAGTTTAAGGGCTGGAAGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013278.3-802s21c1
Sequence:CCGGATCTCCAGCCTCAGTAGTTGGCTCGAGCCAACTACTGAGGCTGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013278.3-368s21c1
Sequence:CCGGTCACCCTGGAGATACCGTGTGCTCGAGCACACGGTATCTCCAGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013278.3-406s21c1
Sequence:CCGGCTATCCACAGAAGCTGGCCTTCTCGAGAAGGCCAGCTTCTGTGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)