EMAIL THIS PAGE TO A FRIEND

IL17D

interleukin 17D

56 Gene Product Result for
Synonyms: IL-17D IL-22 IL-27 IL27
UniProtKB ID: Q8TAD2, B1AM69
Gene ID:
Human(53342) Summary: The protein encoded by this gene is a cytokine that shares the sequence similarity with IL17. The treatment of endothelial cells with this cytokine has been shown to stimulate the production of other cytokines including IL6, IL8 and CSF2/ GM-CSF. The increased expression of IL8 induced by this cytokine was found to be NF-kappa B-dependent. [provided by RefSeq, Jul 2008]
Mouse(239114) interleukin 17D
Rat(691799) interleukin 17D
Zebrafish(553961) interleukin 17d
chicken(428082) interleukin 17D
cow(614982) interleukin 17D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1516 Human IL-17D ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138284 Rosetta Predictions human pricing
XM_001079675 Rosetta Predictions rat pricing
NM_145837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110460 predicted 1125
2 SASI_Hs01_00110461 predicted 635
3 SASI_Hs01_00110462 predicted 1193
4 SASI_Hs01_00110463 predicted 855
5 SASI_Hs02_00363358 predicted 509
6 SASI_Hs01_00110465 predicted 1202
7 SASI_Hs01_00110466 predicted 1078
8 SASI_Hs01_00110464 predicted 425
9 SASI_Hs01_00110468 predicted 359
10 SASI_Hs01_00110469 predicted 852
11 SASI_Hs01_00110467 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365053 predicted 921
2 SASI_Rn02_00365054 predicted 886
3 SASI_Rn02_00365055 predicted 928
4 SASI_Rn02_00365056 predicted 919
5 SASI_Rn02_00365057 predicted 834
6 SASI_Rn02_00365058 predicted 925
7 SASI_Rn02_00365059 predicted 888
8 SASI_Rn02_00365060 predicted 922
9 SASI_Rn02_00365061 predicted 832
10 SASI_Rn02_00365062 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132489 predicted 802
2 SASI_Mm01_00132490 predicted 953
3 SASI_Mm01_00132491 predicted 559
4 SASI_Mm01_00132492 predicted 386
5 SASI_Mm01_00132494 predicted 967
6 SASI_Mm02_00341317 predicted 474
7 SASI_Mm01_00132495 predicted 836
8 SASI_Mm01_00132497 predicted 980
9 SASI_Mm01_00132498 predicted 417
10 SASI_Mm02_00341318 predicted 831
11 SASI_Mm01_00132493 predicted 925
12 SASI_Mm01_00132496 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138284
IL17D MISSION shRNA Bacterial Glycerol Stock
interleukin 17D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-567s21c1
Sequence:CCGGTTCCGTCTACACCGAGGCCTACTCGAGTAGGCCTCGGTGTAGACGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-217s21c1
Sequence:CCGGGAGCTACTGGAGCAGCTGTACCTCGAGGTACAGCTGCTCCAGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-252s1c1
Sequence:CCGGCGGCGTGCTCAGTGCCTTCCACTCGAGTGGAAGGCACTGAGCACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-510s1c1
Sequence:CCGGCCCTGTCTACATGCCCACCGTCTCGAGACGGTGGGCATGTAGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-639s1c1
Sequence:CCGGAGACAGCATCAACTCCAGCATCTCGAGATGCTGGAGTTGATGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-387s1c1
Sequence:CCGGCTGGGCCTACAGAATCTCCTACTCGAGTAGGAGATTCTGTAGGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138284.1-1201s21c1
Sequence:CCGGAGAGCTACTCTGTTACATTTCCTCGAGGAAATGTAACAGAGTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138284.1-1075s21c1
Sequence:CCGGCAAAGAGATAGGGACGCATATCTCGAGATATGCGTCCCTATCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-429s21c1
Sequence:CCGGGTACCTGCCTGAAGCCTACTGCTCGAGCAGTAGGCTTCAGGCAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138284
IL17D MISSION shRNA shRNA Plasmid DNA
interleukin 17D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-567s21c1
Sequence:CCGGTTCCGTCTACACCGAGGCCTACTCGAGTAGGCCTCGGTGTAGACGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-217s21c1
Sequence:CCGGGAGCTACTGGAGCAGCTGTACCTCGAGGTACAGCTGCTCCAGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-252s1c1
Sequence:CCGGCGGCGTGCTCAGTGCCTTCCACTCGAGTGGAAGGCACTGAGCACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-510s1c1
Sequence:CCGGCCCTGTCTACATGCCCACCGTCTCGAGACGGTGGGCATGTAGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-639s1c1
Sequence:CCGGAGACAGCATCAACTCCAGCATCTCGAGATGCTGGAGTTGATGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-387s1c1
Sequence:CCGGCTGGGCCTACAGAATCTCCTACTCGAGTAGGAGATTCTGTAGGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138284.1-1201s21c1
Sequence:CCGGAGAGCTACTCTGTTACATTTCCTCGAGGAAATGTAACAGAGTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138284.1-1075s21c1
Sequence:CCGGCAAAGAGATAGGGACGCATATCTCGAGATATGCGTCCCTATCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-429s21c1
Sequence:CCGGGTACCTGCCTGAAGCCTACTGCTCGAGCAGTAGGCTTCAGGCAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138284
IL17D MISSION shRNA Lentiviral Transduction Particles
interleukin 17D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-567s21c1
Sequence:CCGGTTCCGTCTACACCGAGGCCTACTCGAGTAGGCCTCGGTGTAGACGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-217s21c1
Sequence:CCGGGAGCTACTGGAGCAGCTGTACCTCGAGGTACAGCTGCTCCAGTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-252s1c1
Sequence:CCGGCGGCGTGCTCAGTGCCTTCCACTCGAGTGGAAGGCACTGAGCACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-510s1c1
Sequence:CCGGCCCTGTCTACATGCCCACCGTCTCGAGACGGTGGGCATGTAGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-639s1c1
Sequence:CCGGAGACAGCATCAACTCCAGCATCTCGAGATGCTGGAGTTGATGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138284.1-387s1c1
Sequence:CCGGCTGGGCCTACAGAATCTCCTACTCGAGTAGGAGATTCTGTAGGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138284.1-1201s21c1
Sequence:CCGGAGAGCTACTCTGTTACATTTCCTCGAGGAAATGTAACAGAGTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138284.1-1075s21c1
Sequence:CCGGCAAAGAGATAGGGACGCATATCTCGAGATATGCGTCCCTATCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138284.1-429s21c1
Sequence:CCGGGTACCTGCCTGAAGCCTACTGCTCGAGCAGTAGGCTTCAGGCAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145837
IL17D MISSION shRNA Bacterial Glycerol Stock
interleukin 17D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-816s1c1
Sequence:CCGGGTGTGCCTGAGGCGTACAGTACTCGAGTACTGTACGCCTCAGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-1012s1c1
Sequence:CCGGCGCCGAACACTACATCACCATCTCGAGATGGTGATGTAGTGTTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-934s1c1
Sequence:CCGGCTTTCGCAGCACACCCGTCTTCTCGAGAAGACGGGTGTGCTGCGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-823s1c1
Sequence:CCGGTGAGGCGTACAGTATTTCCTACTCGAGTAGGAAATACTGTACGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-1078s1c1
Sequence:CCGGCAGTGCGAACTCCAGCATGGACTCGAGTCCATGCTGGAGTTCGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145837
IL17D MISSION shRNA shRNA Plasmid DNA
interleukin 17D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-816s1c1
Sequence:CCGGGTGTGCCTGAGGCGTACAGTACTCGAGTACTGTACGCCTCAGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-1012s1c1
Sequence:CCGGCGCCGAACACTACATCACCATCTCGAGATGGTGATGTAGTGTTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-934s1c1
Sequence:CCGGCTTTCGCAGCACACCCGTCTTCTCGAGAAGACGGGTGTGCTGCGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-823s1c1
Sequence:CCGGTGAGGCGTACAGTATTTCCTACTCGAGTAGGAAATACTGTACGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-1078s1c1
Sequence:CCGGCAGTGCGAACTCCAGCATGGACTCGAGTCCATGCTGGAGTTCGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145837
IL17D MISSION shRNA Lentiviral Transduction Particles
interleukin 17D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-816s1c1
Sequence:CCGGGTGTGCCTGAGGCGTACAGTACTCGAGTACTGTACGCCTCAGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-1012s1c1
Sequence:CCGGCGCCGAACACTACATCACCATCTCGAGATGGTGATGTAGTGTTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-934s1c1
Sequence:CCGGCTTTCGCAGCACACCCGTCTTCTCGAGAAGACGGGTGTGCTGCGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-823s1c1
Sequence:CCGGTGAGGCGTACAGTATTTCCTACTCGAGTAGGAAATACTGTACGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145837.1-1078s1c1
Sequence:CCGGCAGTGCGAACTCCAGCATGGACTCGAGTCCATGCTGGAGTTCGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)