EMAIL THIS PAGE TO A FRIEND

IL17F

interleukin 17F

72 Gene Product Result for
Synonyms: CANDF6 IL-17F ML-1 ML1
UniProtKB ID: Q96PD4, Q6NSI0, Q7Z6P4, Q96PI8, Q9NUE6
Gene ID:
Human(112744) Summary: The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008]
Mouse(257630) interleukin 17F
Rat(301291) interleukin 17F
sheep(101104186) interleukin 17F
naked mole-rat(101696616) interleukin 17F
chicken(395111) interleukin 17F
cow(506030) interleukin 17F
domestic cat(101095826) interleukin 17F
chicken(428665) interleukin 17F
dog(481838) interleukin 17F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052872 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052872 Rosetta Predictions human pricing
NM_001015011 Rosetta Predictions rat pricing
NM_145856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096634 predicted 463
2 SASI_Hs01_00096635 predicted 575
3 SASI_Hs01_00096636 predicted 565
4 SASI_Hs01_00096637 predicted 469
5 SASI_Hs01_00096638 predicted 542
6 SASI_Hs01_00096639 predicted 566
7 SASI_Hs01_00096640 predicted 555
8 SASI_Hs01_00096641 predicted 548
9 SASI_Hs01_00096642 predicted 536
10 SASI_Hs01_00096643 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201981 predicted 831
2 SASI_Rn02_00201982 predicted 345
3 SASI_Rn02_00201983 predicted 805
4 SASI_Rn02_00201984 predicted 863
5 SASI_Rn02_00201985 predicted 751
6 SASI_Rn02_00201986 predicted 327
7 SASI_Rn02_00201987 predicted 584
8 SASI_Rn02_00201988 predicted 815
9 SASI_Rn02_00201989 predicted 795
10 SASI_Rn02_00201990 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341352 predicted 841
2 SASI_Mm02_00341353 predicted 858
3 SASI_Mm02_00341354 predicted 621
4 SASI_Mm02_00341355 predicted 638
5 SASI_Mm01_00141722 predicted 234
6 SASI_Mm02_00341356 predicted 896
7 SASI_Mm02_00341357 predicted 882
8 SASI_Mm02_00341358 predicted 405
9 SASI_Mm02_00341359 predicted 844
10 SASI_Mm01_00141725 predicted 378
11 SASI_Mm01_00141719 predicted 219
12 SASI_Mm01_00141720 predicted 134
13 SASI_Mm01_00141721 predicted 47
14 SASI_Mm01_00141723 predicted 29
15 SASI_Mm01_00141724 predicted 129
16 SASI_Mm01_00141726 predicted 436
17 SASI_Mm01_00141727 predicted 127
18 SASI_Mm01_00141728 predicted 173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145856
IL17F MISSION shRNA Bacterial Glycerol Stock
interleukin 17F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-170s1c1
Sequence:CCGGGCATTTCTGTCCCACGTGAATCTCGAGATTCACGTGGGACAGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-34s1c1
Sequence:CCGGCTTGCCATTCTGAGGGAGGTACTCGAGTACCTCCCTCAGAATGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-211s1c1
Sequence:CCGGCCATGGGATTACAACATCACTCTCGAGAGTGATGTTGTAATCCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-306s1c1
Sequence:CCGGTCAGGAAGACAGCACCATGAACTCGAGTTCATGGTGCTGTCTTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-142s1c1
Sequence:CCGGGACATTCGAATCTTCAACCAACTCGAGTTGGTTGAAGATTCGAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145856
IL17F MISSION shRNA shRNA Plasmid DNA
interleukin 17F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-170s1c1
Sequence:CCGGGCATTTCTGTCCCACGTGAATCTCGAGATTCACGTGGGACAGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-34s1c1
Sequence:CCGGCTTGCCATTCTGAGGGAGGTACTCGAGTACCTCCCTCAGAATGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-211s1c1
Sequence:CCGGCCATGGGATTACAACATCACTCTCGAGAGTGATGTTGTAATCCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-306s1c1
Sequence:CCGGTCAGGAAGACAGCACCATGAACTCGAGTTCATGGTGCTGTCTTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-142s1c1
Sequence:CCGGGACATTCGAATCTTCAACCAACTCGAGTTGGTTGAAGATTCGAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145856
IL17F MISSION shRNA Lentiviral Transduction Particles
interleukin 17F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-170s1c1
Sequence:CCGGGCATTTCTGTCCCACGTGAATCTCGAGATTCACGTGGGACAGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-34s1c1
Sequence:CCGGCTTGCCATTCTGAGGGAGGTACTCGAGTACCTCCCTCAGAATGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-211s1c1
Sequence:CCGGCCATGGGATTACAACATCACTCTCGAGAGTGATGTTGTAATCCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-306s1c1
Sequence:CCGGTCAGGAAGACAGCACCATGAACTCGAGTTCATGGTGCTGTCTTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145856.1-142s1c1
Sequence:CCGGGACATTCGAATCTTCAACCAACTCGAGTTGGTTGAAGATTCGAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052872
IL17F MISSION shRNA Bacterial Glycerol Stock
interleukin 17F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-317s1c1
Sequence:CCGGGCTGCATCAATGCTCAAGGAACTCGAGTTCCTTGAGCATTGATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-201s1c1
Sequence:CCGGCGTTTCCATGTCACGTAACATCTCGAGATGTTACGTGACATGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-169s1c1
Sequence:CCGGCTTGACATTGGCATCATCAATCTCGAGATTGATGATGCCAATGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-348s1c1
Sequence:CCGGCTCCATGAATTCCGTTCCCATCTCGAGATGGGAACGGAATTCATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-242s1c1
Sequence:CCGGCCTGGAATTACACTGTCACTTCTCGAGAAGTGACAGTGTAATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-110s21c1
Sequence:CCGGGTACTTGCTGCTGTCGATATTCTCGAGAATATCGACAGCAGCAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-544s21c1
Sequence:CCGGTCATCCACCATGTGCAGTAAGCTCGAGCTTACTGCACATGGTGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-218s21c1
Sequence:CCGGTGTGCCAGGAGGTAGTATGAACTCGAGTTCATACTACCTCCTGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052872
IL17F MISSION shRNA shRNA Plasmid DNA
interleukin 17F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-317s1c1
Sequence:CCGGGCTGCATCAATGCTCAAGGAACTCGAGTTCCTTGAGCATTGATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-201s1c1
Sequence:CCGGCGTTTCCATGTCACGTAACATCTCGAGATGTTACGTGACATGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-169s1c1
Sequence:CCGGCTTGACATTGGCATCATCAATCTCGAGATTGATGATGCCAATGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-348s1c1
Sequence:CCGGCTCCATGAATTCCGTTCCCATCTCGAGATGGGAACGGAATTCATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-242s1c1
Sequence:CCGGCCTGGAATTACACTGTCACTTCTCGAGAAGTGACAGTGTAATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-110s21c1
Sequence:CCGGGTACTTGCTGCTGTCGATATTCTCGAGAATATCGACAGCAGCAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-544s21c1
Sequence:CCGGTCATCCACCATGTGCAGTAAGCTCGAGCTTACTGCACATGGTGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-218s21c1
Sequence:CCGGTGTGCCAGGAGGTAGTATGAACTCGAGTTCATACTACCTCCTGGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052872
IL17F MISSION shRNA Lentiviral Transduction Particles
interleukin 17F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-317s1c1
Sequence:CCGGGCTGCATCAATGCTCAAGGAACTCGAGTTCCTTGAGCATTGATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-201s1c1
Sequence:CCGGCGTTTCCATGTCACGTAACATCTCGAGATGTTACGTGACATGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-169s1c1
Sequence:CCGGCTTGACATTGGCATCATCAATCTCGAGATTGATGATGCCAATGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-348s1c1
Sequence:CCGGCTCCATGAATTCCGTTCCCATCTCGAGATGGGAACGGAATTCATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052872.2-242s1c1
Sequence:CCGGCCTGGAATTACACTGTCACTTCTCGAGAAGTGACAGTGTAATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-110s21c1
Sequence:CCGGGTACTTGCTGCTGTCGATATTCTCGAGAATATCGACAGCAGCAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-544s21c1
Sequence:CCGGTCATCCACCATGTGCAGTAAGCTCGAGCTTACTGCACATGGTGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052872.3-218s21c1
Sequence:CCGGTGTGCCAGGAGGTAGTATGAACTCGAGTTCATACTACCTCCTGGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)