EMAIL THIS PAGE TO A FRIEND

IL17RB

interleukin 17 receptor B

64 Gene Product Result for
Synonyms: CRL4 EVI27 IL17BR IL17RH1
UniProtKB ID: Q9NRM6, Q9BPZ0, Q9NRL4, Q9NRM5
Gene ID:
Human(55540) Summary: The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]
Mouse(50905) interleukin 17 receptor B
Rat(306247) interleukin 17 receptor B
sheep(101105858) interleukin 17 receptor B
Domestic Rabbit(100350821) interleukin 17 receptor B
domestic guinea pig(100724724) interleukin 17 receptor B
naked mole-rat(101713914) interleukin 17 receptor B
domestic cat(101080437) interleukin 17 receptor B
cow(533605) interleukin 17 receptor B
dog(476587) interleukin 17 receptor B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018725 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060131 MISSION® esiRNA esiRNA human IL17RB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018725 Rosetta Predictions human pricing
NM_172234 Rosetta Predictions human pricing
NM_001107290 Rosetta Predictions rat pricing
NM_019583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200323 predicted 1573
2 SASI_Hs01_00200324 predicted 1198
3 SASI_Hs01_00200326 predicted 1561
4 SASI_Hs01_00200327 predicted 1633
5 SASI_Hs01_00200328 predicted 1400
6 SASI_Hs02_00352268 predicted 1227
7 SASI_Hs02_00352269 predicted 1634
8 SASI_Hs02_00352270 predicted 1028
9 SASI_Hs02_00352271 predicted 1041
10 SASI_Hs01_00200332 predicted 1065
11 SASI_Hs01_00200325 predicted 1651
12 SASI_Hs01_00200329 predicted 1542
13 SASI_Hs01_00200330 predicted 1051
14 SASI_Hs01_00200331 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234906 predicted 463
2 SASI_Hs01_00234907 predicted 902
3 SASI_Hs01_00234908 predicted 711
4 SASI_Hs01_00234909 predicted 832
5 SASI_Hs01_00234910 predicted 149
6 SASI_Hs01_00234911 predicted 659
7 SASI_Hs01_00234912 predicted 665
8 SASI_Hs01_00234913 predicted 1112
9 SASI_Hs01_00234914 predicted 738
10 SASI_Hs01_00234915 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227385 predicted 1113
2 SASI_Rn02_00227386 predicted 669
3 SASI_Rn02_00227387 predicted 1670
4 SASI_Rn02_00227388 predicted 1091
5 SASI_Rn02_00227389 predicted 1247
6 SASI_Rn02_00227390 predicted 1249
7 SASI_Rn02_00227391 predicted 591
8 SASI_Rn02_00227392 predicted 582
9 SASI_Rn02_00227393 predicted 1347
10 SASI_Rn02_00227394 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108892 predicted 1565
2 SASI_Mm01_00108893 predicted 721
3 SASI_Mm01_00108894 predicted 891
4 SASI_Mm01_00108895 predicted 705
5 SASI_Mm01_00108896 predicted 713
6 SASI_Mm01_00108897 predicted 1526
7 SASI_Mm01_00108898 predicted 425
8 SASI_Mm01_00108899 predicted 1352
9 SASI_Mm01_00108900 predicted 1652
10 SASI_Mm01_00108901 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019583
IL17RB MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019583.1-972s1c1
Sequence:CCGGCGTGGAAGAATGGTTTCCTATCTCGAGATAGGAAACCATTCTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-468s1c1
Sequence:CCGGCCCTTCTTTGTCTGTGAACTTCTCGAGAAGTTCACAGACAAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-417s1c1
Sequence:CCGGCTATCTCATCAGCGCCCATAACTCGAGTTATGGGCGCTGATGAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-366s1c1
Sequence:CCGGCGGCAAATGGACATTCTCCTACTCGAGTAGGAGAATGTCCATTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019583.3-1405s21c1
Sequence:CCGGCAGACGCATCTGCACAAATACCTCGAGGTATTTGTGCAGATGCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019583.3-1819s21c1
Sequence:CCGGTAATGAGTGGGACCTACATTTCTCGAGAAATGTAGGTCCCACTCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019583.3-590s21c1
Sequence:CCGGGCCTAAACCACGTAATGAAATCTCGAGATTTCATTACGTGGTTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019583.3-1774s21c1
Sequence:CCGGGCTAGTCATTGGCTGGATTTACTCGAGTAAATCCAGCCAATGACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019583
IL17RB MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019583.1-972s1c1
Sequence:CCGGCGTGGAAGAATGGTTTCCTATCTCGAGATAGGAAACCATTCTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-468s1c1
Sequence:CCGGCCCTTCTTTGTCTGTGAACTTCTCGAGAAGTTCACAGACAAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-417s1c1
Sequence:CCGGCTATCTCATCAGCGCCCATAACTCGAGTTATGGGCGCTGATGAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-366s1c1
Sequence:CCGGCGGCAAATGGACATTCTCCTACTCGAGTAGGAGAATGTCCATTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019583.3-1405s21c1
Sequence:CCGGCAGACGCATCTGCACAAATACCTCGAGGTATTTGTGCAGATGCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019583.3-1819s21c1
Sequence:CCGGTAATGAGTGGGACCTACATTTCTCGAGAAATGTAGGTCCCACTCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019583.3-590s21c1
Sequence:CCGGGCCTAAACCACGTAATGAAATCTCGAGATTTCATTACGTGGTTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019583.3-1774s21c1
Sequence:CCGGGCTAGTCATTGGCTGGATTTACTCGAGTAAATCCAGCCAATGACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019583
IL17RB MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019583.1-972s1c1
Sequence:CCGGCGTGGAAGAATGGTTTCCTATCTCGAGATAGGAAACCATTCTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-468s1c1
Sequence:CCGGCCCTTCTTTGTCTGTGAACTTCTCGAGAAGTTCACAGACAAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-417s1c1
Sequence:CCGGCTATCTCATCAGCGCCCATAACTCGAGTTATGGGCGCTGATGAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019583.1-366s1c1
Sequence:CCGGCGGCAAATGGACATTCTCCTACTCGAGTAGGAGAATGTCCATTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019583.3-1405s21c1
Sequence:CCGGCAGACGCATCTGCACAAATACCTCGAGGTATTTGTGCAGATGCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019583.3-1819s21c1
Sequence:CCGGTAATGAGTGGGACCTACATTTCTCGAGAAATGTAGGTCCCACTCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019583.3-590s21c1
Sequence:CCGGGCCTAAACCACGTAATGAAATCTCGAGATTTCATTACGTGGTTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019583.3-1774s21c1
Sequence:CCGGGCTAGTCATTGGCTGGATTTACTCGAGTAAATCCAGCCAATGACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018725
IL17RB MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-494s1c1
Sequence:CCGGCCCTTCCATGTCTGTGAATTTCTCGAGAAATTCACAGACATGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1076s1c1
Sequence:CCGGCCATCACACAATTTGTTACTTCTCGAGAAGTAACAAATTGTGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-457s1c1
Sequence:CCGGCCCATAATATTCCTAATGCAACTCGAGTTGCATTAGGAATATTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1377s1c1
Sequence:CCGGGTGGTCTACTTTAGAGAGATTCTCGAGAATCTCTCTAAAGTAGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1036s1c1
Sequence:CCGGCCATTAAGGTTCTTGTGGTTTCTCGAGAAACCACAAGAACCTTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018725.3-141s21c1
Sequence:CCGGGATGCTACAACATGATCTAATCTCGAGATTAGATCATGTTGTAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018725.3-1872s21c1
Sequence:CCGGCCAGAACTGTTTAGCTAATATCTCGAGATATTAGCTAAACAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018725.3-813s21c1
Sequence:CCGGCAGCGACTGCATCCGACATAACTCGAGTTATGTCGGATGCAGTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018725
IL17RB MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-494s1c1
Sequence:CCGGCCCTTCCATGTCTGTGAATTTCTCGAGAAATTCACAGACATGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1076s1c1
Sequence:CCGGCCATCACACAATTTGTTACTTCTCGAGAAGTAACAAATTGTGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-457s1c1
Sequence:CCGGCCCATAATATTCCTAATGCAACTCGAGTTGCATTAGGAATATTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1377s1c1
Sequence:CCGGGTGGTCTACTTTAGAGAGATTCTCGAGAATCTCTCTAAAGTAGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1036s1c1
Sequence:CCGGCCATTAAGGTTCTTGTGGTTTCTCGAGAAACCACAAGAACCTTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018725.3-141s21c1
Sequence:CCGGGATGCTACAACATGATCTAATCTCGAGATTAGATCATGTTGTAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018725.3-1872s21c1
Sequence:CCGGCCAGAACTGTTTAGCTAATATCTCGAGATATTAGCTAAACAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018725.3-813s21c1
Sequence:CCGGCAGCGACTGCATCCGACATAACTCGAGTTATGTCGGATGCAGTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018725
IL17RB MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-494s1c1
Sequence:CCGGCCCTTCCATGTCTGTGAATTTCTCGAGAAATTCACAGACATGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1076s1c1
Sequence:CCGGCCATCACACAATTTGTTACTTCTCGAGAAGTAACAAATTGTGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-457s1c1
Sequence:CCGGCCCATAATATTCCTAATGCAACTCGAGTTGCATTAGGAATATTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1377s1c1
Sequence:CCGGGTGGTCTACTTTAGAGAGATTCTCGAGAATCTCTCTAAAGTAGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018725.2-1036s1c1
Sequence:CCGGCCATTAAGGTTCTTGTGGTTTCTCGAGAAACCACAAGAACCTTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018725.3-141s21c1
Sequence:CCGGGATGCTACAACATGATCTAATCTCGAGATTAGATCATGTTGTAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018725.3-1872s21c1
Sequence:CCGGCCAGAACTGTTTAGCTAATATCTCGAGATATTAGCTAAACAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018725.3-813s21c1
Sequence:CCGGCAGCGACTGCATCCGACATAACTCGAGTTATGTCGGATGCAGTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)