EMAIL THIS PAGE TO A FRIEND

IL17RD

interleukin 17 receptor D

306 Gene Product Result for
Synonyms: HH18 IL-17RD IL17RLM SEF
Gene ID:
Human(54756) Summary: This gene encodes a membrane protein belonging to the interleukin-17 receptor (IL-17R) protein family. The encoded protein is a component of the interleukin-17 receptor signaling complex, and the interaction between this protein and IL-17R does not require the interleukin (PMID: 19079364). The gene product also affects fibroblast growth factor signaling, inhibiting or stimulating growth through MAPK/ERK signaling (PMID: 21663947, 18096367). [provided by RefSeq, Nov 2011]
Mouse(171463) interleukin 17 receptor D
Rat(498576) interleukin 17 receptor D
sheep(101109490) interleukin 17 receptor D
Domestic Rabbit(100352844) interleukin 17 receptor D
domestic guinea pig(100724726) interleukin 17 receptor D
naked mole-rat(101704523) interleukin 17 receptor D
Zebrafish(171474) interleukin 17 receptor D
cow(782214) interleukin 17 receptor D
Horse(100058731) interleukin 17 receptor D
domestic cat(101096454) interleukin 17 receptor D
dog(484719) interleukin 17 receptor D
chicken(395186) interleukin 17 receptor D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017563 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017563 Rosetta Predictions human pricing
XM_001055324 Rosetta Predictions rat pricing
XM_573851 Rosetta Predictions rat pricing
NM_134437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174683 predicted 806
2 SASI_Hs01_00174684 predicted 1216
3 SASI_Hs01_00174685 predicted 2311
4 SASI_Hs01_00174686 predicted 516
5 SASI_Hs01_00174687 predicted 1338
6 SASI_Hs01_00174688 predicted 936
7 SASI_Hs01_00174682 predicted 747
8 SASI_Hs01_00174690 predicted 1678
9 SASI_Hs02_00350217 predicted 1809
10 SASI_Hs01_00174691 predicted 1509
11 SASI_Hs01_00174689 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279207 predicted 676
2 SASI_Rn02_00279208 predicted 1289
3 SASI_Rn02_00279209 predicted 735
4 SASI_Rn02_00279210 predicted 1902
5 SASI_Rn02_00279211 predicted 1964
6 SASI_Rn02_00279212 predicted 741
7 SASI_Rn02_00279213 predicted 1431
8 SASI_Rn02_00279214 predicted 1083
9 SASI_Rn02_00279215 predicted 1951
10 SASI_Rn02_00279216 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400884 predicted 683
2 SASI_Rn02_00400885 predicted 603
3 SASI_Rn02_00400886 predicted 613
4 SASI_Rn02_00400887 predicted 735
5 SASI_Rn02_00400888 predicted 786
6 SASI_Rn02_00400889 predicted 745
7 SASI_Rn02_00400890 predicted 427
8 SASI_Rn02_00400891 predicted 835
9 SASI_Rn02_00400892 predicted 1085
10 SASI_Rn02_00400893 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049523 predicted 1516
2 SASI_Mm01_00049524 predicted 665
3 SASI_Mm01_00049525 predicted 616
4 SASI_Mm01_00049526 predicted 1901
5 SASI_Mm01_00049527 predicted 2088
6 SASI_Mm01_00049528 predicted 1228
7 SASI_Mm01_00049529 predicted 1323
8 SASI_Mm01_00049530 predicted 1345
9 SASI_Mm01_00049531 predicted 677
10 SASI_Mm01_00049532 predicted 2306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134437
IL17RD MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134437.1-2390s1c1
Sequence:CCGGCCAGCCTTCTAAGGGATACTTCTCGAGAAGTATCCCTTAGAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-1635s1c1
Sequence:CCGGGCTCCCTGTATGTTGCCATTTCTCGAGAAATGGCAACATACAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-466s1c1
Sequence:CCGGGCCTTTCCTGAATATGAAATTCTCGAGAATTTCATATTCAGGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-181s1c1
Sequence:CCGGGCACAACATCACCTTCAGATACTCGAGTATCTGAAGGTGATGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-2073s1c1
Sequence:CCGGCGGATCAGATAGAAACATCTTCTCGAGAAGATGTTTCTATCTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134437
IL17RD MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134437.1-2390s1c1
Sequence:CCGGCCAGCCTTCTAAGGGATACTTCTCGAGAAGTATCCCTTAGAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-1635s1c1
Sequence:CCGGGCTCCCTGTATGTTGCCATTTCTCGAGAAATGGCAACATACAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-466s1c1
Sequence:CCGGGCCTTTCCTGAATATGAAATTCTCGAGAATTTCATATTCAGGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-181s1c1
Sequence:CCGGGCACAACATCACCTTCAGATACTCGAGTATCTGAAGGTGATGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-2073s1c1
Sequence:CCGGCGGATCAGATAGAAACATCTTCTCGAGAAGATGTTTCTATCTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134437
IL17RD MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134437.1-2390s1c1
Sequence:CCGGCCAGCCTTCTAAGGGATACTTCTCGAGAAGTATCCCTTAGAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-1635s1c1
Sequence:CCGGGCTCCCTGTATGTTGCCATTTCTCGAGAAATGGCAACATACAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-466s1c1
Sequence:CCGGGCCTTTCCTGAATATGAAATTCTCGAGAATTTCATATTCAGGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-181s1c1
Sequence:CCGGGCACAACATCACCTTCAGATACTCGAGTATCTGAAGGTGATGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134437.1-2073s1c1
Sequence:CCGGCGGATCAGATAGAAACATCTTCTCGAGAAGATGTTTCTATCTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017563
IL17RD MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-661s1c1
Sequence:CCGGCCGGACAATCTAGCTTGTAAACTCGAGTTTACAAGCTAGATTGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1819s1c1
Sequence:CCGGCCAGTCTTGGAGAAATTTGATCTCGAGATCAAATTTCTCCAAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1708s1c1
Sequence:CCGGCGGTCCCTATACGTCGCCATTCTCGAGAATGGCGACGTATAGGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1052s1c1
Sequence:CCGGGCCGCAAGAAGCAACAAGAAACTCGAGTTTCTTGTTGCTTCTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-771s1c1
Sequence:CCGGCCGTTTCTTCTATCTTCACTACTCGAGTAGTGAAGATAGAAGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017563.3-411s21c1
Sequence:CCGGCTGAAAGGATTTCGGGTAATACTCGAGTATTACCCGAAATCCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017563.3-555s21c1
Sequence:CCGGGAAACGGATTATTTCGTAAAGCTCGAGCTTTACGAAATAATCCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017563
IL17RD MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-661s1c1
Sequence:CCGGCCGGACAATCTAGCTTGTAAACTCGAGTTTACAAGCTAGATTGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1819s1c1
Sequence:CCGGCCAGTCTTGGAGAAATTTGATCTCGAGATCAAATTTCTCCAAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1708s1c1
Sequence:CCGGCGGTCCCTATACGTCGCCATTCTCGAGAATGGCGACGTATAGGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1052s1c1
Sequence:CCGGGCCGCAAGAAGCAACAAGAAACTCGAGTTTCTTGTTGCTTCTTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-771s1c1
Sequence:CCGGCCGTTTCTTCTATCTTCACTACTCGAGTAGTGAAGATAGAAGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017563.3-411s21c1
Sequence:CCGGCTGAAAGGATTTCGGGTAATACTCGAGTATTACCCGAAATCCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017563.3-555s21c1
Sequence:CCGGGAAACGGATTATTTCGTAAAGCTCGAGCTTTACGAAATAATCCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017563
IL17RD MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-661s1c1
Sequence:CCGGCCGGACAATCTAGCTTGTAAACTCGAGTTTACAAGCTAGATTGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1819s1c1
Sequence:CCGGCCAGTCTTGGAGAAATTTGATCTCGAGATCAAATTTCTCCAAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1708s1c1
Sequence:CCGGCGGTCCCTATACGTCGCCATTCTCGAGAATGGCGACGTATAGGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-1052s1c1
Sequence:CCGGGCCGCAAGAAGCAACAAGAAACTCGAGTTTCTTGTTGCTTCTTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017563.1-771s1c1
Sequence:CCGGCCGTTTCTTCTATCTTCACTACTCGAGTAGTGAAGATAGAAGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017563.3-411s21c1
Sequence:CCGGCTGAAAGGATTTCGGGTAATACTCGAGTATTACCCGAAATCCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017563.3-555s21c1
Sequence:CCGGGAAACGGATTATTTCGTAAAGCTCGAGCTTTACGAAATAATCCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)