EMAIL THIS PAGE TO A FRIEND

IL17RE

interleukin 17 receptor E

118 Gene Product Result for
Gene ID:
Human(132014) Summary: This gene encodes a protein that shares limited similarity with the interleukin-17 receptor. The function of the encoded protein has not yet been determined. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Mouse(57890) interleukin 17 receptor E
Rat(362417) interleukin 17 receptor E
cow(783335) interleukin 17 receptor E
domestic cat(101091853) interleukin 17 receptor E
dog(476538) interleukin 17 receptor E
naked mole-rat(101700580) interleukin 17 receptor E
sheep(101123669) interleukin 17 receptor E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144640 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028081 MISSION® esiRNA esiRNA targeting mouse Il17re (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144640 Rosetta Predictions human pricing
NM_153480 Rosetta Predictions human pricing
NM_153481 Rosetta Predictions human pricing
NM_153482 Rosetta Predictions human pricing
NM_153483 Rosetta Predictions human pricing
NM_001004091 Rosetta Predictions rat pricing
NM_001034029 Rosetta Predictions mouse pricing
NM_001034031 Rosetta Predictions mouse pricing
NM_145826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050154 predicted 611
2 SASI_Hs01_00050155 predicted 1078
3 SASI_Hs01_00050156 predicted 600
4 SASI_Hs01_00050157 predicted 1184
5 SASI_Hs01_00050158 predicted 1026
6 SASI_Hs01_00050159 predicted 924
7 SASI_Hs01_00050160 predicted 594
8 SASI_Hs01_00050161 predicted 791
9 SASI_Hs01_00050162 predicted 1182
10 SASI_Hs01_00050163 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049025 predicted 611
2 SASI_Hs01_00049026 predicted 1064
3 SASI_Hs01_00049027 predicted 597
4 SASI_Hs01_00049028 predicted 1181
5 SASI_Hs01_00049029 predicted 2381
6 SASI_Hs01_00049030 predicted 2292
7 SASI_Hs01_00049031 predicted 1029
8 SASI_Hs01_00049032 predicted 920
9 SASI_Hs01_00049033 predicted 584
10 SASI_Hs01_00049034 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201197 predicted 934
2 SASI_Hs01_00201198 predicted 462
3 SASI_Hs01_00201199 predicted 1041
4 SASI_Hs01_00201200 predicted 2248
5 SASI_Hs01_00201201 predicted 2153
6 SASI_Hs01_00201202 predicted 894
7 SASI_Hs01_00201203 predicted 787
8 SASI_Hs01_00201204 predicted 451
9 SASI_Hs01_00201205 predicted 648
10 SASI_Hs01_00201206 predicted 1944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244704 predicted 602
2 SASI_Hs01_00244705 predicted 1056
3 SASI_Hs01_00244706 predicted 587
4 SASI_Hs01_00244707 predicted 1164
5 SASI_Hs01_00244708 predicted 1016
6 SASI_Hs01_00244709 predicted 916
7 SASI_Hs01_00244710 predicted 572
8 SASI_Hs01_00244711 predicted 773
9 SASI_Hs01_00244712 predicted 1161
10 SASI_Hs01_00244713 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137794 predicted 1076
2 SASI_Hs01_00137795 predicted 612
3 SASI_Hs01_00137796 predicted 1193
4 SASI_Hs01_00137797 predicted 2397
5 SASI_Hs01_00137798 predicted 2297
6 SASI_Hs01_00137799 predicted 1034
7 SASI_Hs01_00137800 predicted 938
8 SASI_Hs01_00137801 predicted 601
9 SASI_Hs01_00137802 predicted 800
10 SASI_Hs01_00137803 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107001 predicted 1355
2 SASI_Rn01_00107002 predicted 357
3 SASI_Rn01_00107003 predicted 1204
4 SASI_Rn01_00107004 predicted 553
5 SASI_Rn01_00107005 predicted 1154
6 SASI_Rn01_00107006 predicted 481
7 SASI_Rn01_00107007 predicted 510
8 SASI_Rn01_00107008 predicted 277
9 SASI_Rn02_00198142 predicted 632
10 SASI_Rn01_00107010 predicted 1965
11 SASI_Rn01_00107009 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037485 predicted 698
2 SASI_Mm02_00289077 predicted 835
3 SASI_Mm02_00289078 predicted 1229
4 SASI_Mm02_00289079 predicted 825
5 SASI_Mm02_00289080 predicted 1092
6 SASI_Mm01_00037486 predicted 881
7 SASI_Mm02_00289081 predicted 871
8 SASI_Mm01_00037487 predicted 874
9 SASI_Mm01_00037489 predicted 954
10 SASI_Mm01_00037490 predicted 921
11 SASI_Mm01_00037484 predicted 828
12 SASI_Mm01_00037488 predicted 1528
13 SASI_Mm01_00037491 predicted 657
14 SASI_Mm01_00037492 predicted 644
15 SASI_Mm01_00037493 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148021 predicted 771
2 SASI_Mm02_00289084 predicted 909
3 SASI_Mm02_00289085 predicted 1305
4 SASI_Mm02_00289086 predicted 901
5 SASI_Mm02_00289087 predicted 1167
6 SASI_Mm01_00148022 predicted 955
7 SASI_Mm02_00289088 predicted 951
8 SASI_Mm01_00148023 predicted 942
9 SASI_Mm01_00148025 predicted 1027
10 SASI_Mm01_00148026 predicted 996
11 SASI_Mm01_00148020 predicted 903
12 SASI_Mm01_00148024 predicted 1596
13 SASI_Mm01_00148027 predicted 726
14 SASI_Mm01_00148028 predicted 717
15 SASI_Mm01_00148029 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097247 predicted 1125
2 SASI_Mm01_00097248 predicted 851
3 SASI_Mm01_00097249 predicted 883
4 SASI_Mm01_00097250 predicted 1250
5 SASI_Mm02_00341292 predicted 1518
6 SASI_Mm01_00097251 predicted 788
7 SASI_Mm01_00097252 predicted 1308
8 SASI_Mm01_00097253 predicted 1302
9 SASI_Mm01_00097254 predicted 817
10 SASI_Mm01_00097255 predicted 1372
11 SASI_Mm01_00097256 predicted 1361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153483
IL17RE MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor E
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000372554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153483.1-2189s21c1
Sequence:CCGGATGAGCCTTCGACCCTGAAATCTCGAGATTTCAGGGTCGAAGGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153483.1-556s21c1
Sequence:CCGGCACAAGGGACTTCGCTCTAAACTCGAGTTTAGAGCGAAGTCCCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153483
IL17RE MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor E
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000372554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153483.1-2189s21c1
Sequence:CCGGATGAGCCTTCGACCCTGAAATCTCGAGATTTCAGGGTCGAAGGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153483.1-556s21c1
Sequence:CCGGCACAAGGGACTTCGCTCTAAACTCGAGTTTAGAGCGAAGTCCCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153483
IL17RE MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor E
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000372554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153483.1-2189s21c1
Sequence:CCGGATGAGCCTTCGACCCTGAAATCTCGAGATTTCAGGGTCGAAGGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153483.1-556s21c1
Sequence:CCGGCACAAGGGACTTCGCTCTAAACTCGAGTTTAGAGCGAAGTCCCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145826
IL17RE MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1140s1c1
Sequence:CCGGCCAGCACAATCAGATGGTCATCTCGAGATGACCATCTGATTGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1745s1c1
Sequence:CCGGCCGGTCGAACAAGGCCAGTTTCTCGAGAAACTGGCCTTGTTCGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-610s1c1
Sequence:CCGGCCTCCTAAATTTGAAGACTATCTCGAGATAGTCTTCAAATTTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1308s1c1
Sequence:CCGGGCTCTGCTTTAAGTTCTCATTCTCGAGAATGAGAACTTAAAGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-2294s1c1
Sequence:CCGGCAACCAATAGTCCCTGTGGTTCTCGAGAACCACAGGGACTATTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145826
IL17RE MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1140s1c1
Sequence:CCGGCCAGCACAATCAGATGGTCATCTCGAGATGACCATCTGATTGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1745s1c1
Sequence:CCGGCCGGTCGAACAAGGCCAGTTTCTCGAGAAACTGGCCTTGTTCGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-610s1c1
Sequence:CCGGCCTCCTAAATTTGAAGACTATCTCGAGATAGTCTTCAAATTTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1308s1c1
Sequence:CCGGGCTCTGCTTTAAGTTCTCATTCTCGAGAATGAGAACTTAAAGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-2294s1c1
Sequence:CCGGCAACCAATAGTCCCTGTGGTTCTCGAGAACCACAGGGACTATTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145826
IL17RE MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1140s1c1
Sequence:CCGGCCAGCACAATCAGATGGTCATCTCGAGATGACCATCTGATTGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1745s1c1
Sequence:CCGGCCGGTCGAACAAGGCCAGTTTCTCGAGAAACTGGCCTTGTTCGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-610s1c1
Sequence:CCGGCCTCCTAAATTTGAAGACTATCTCGAGATAGTCTTCAAATTTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-1308s1c1
Sequence:CCGGGCTCTGCTTTAAGTTCTCATTCTCGAGAATGAGAACTTAAAGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145826.2-2294s1c1
Sequence:CCGGCAACCAATAGTCCCTGTGGTTCTCGAGAACCACAGGGACTATTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144640
IL17RE MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1119s1c1
Sequence:CCGGGCTCTGCTTCAAGTTCTCTTTCTCGAGAAAGAGAACTTGAAGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-583s1c1
Sequence:CCGGCCAGAGACATGGGAAAGTCTTCTCGAGAAGACTTTCCCATGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1351s1c1
Sequence:CCGGGTGTCACTAGACCTCATCATTCTCGAGAATGATGAGGTCTAGTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-249s1c1
Sequence:CCGGCACTGGAAGTTCTGCCTATATCTCGAGATATAGGCAGAACTTCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1190s1c1
Sequence:CCGGCCTGGAATGTAAGCATGGATACTCGAGTATCCATGCTTACATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144640
IL17RE MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1119s1c1
Sequence:CCGGGCTCTGCTTCAAGTTCTCTTTCTCGAGAAAGAGAACTTGAAGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-583s1c1
Sequence:CCGGCCAGAGACATGGGAAAGTCTTCTCGAGAAGACTTTCCCATGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1351s1c1
Sequence:CCGGGTGTCACTAGACCTCATCATTCTCGAGAATGATGAGGTCTAGTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-249s1c1
Sequence:CCGGCACTGGAAGTTCTGCCTATATCTCGAGATATAGGCAGAACTTCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1190s1c1
Sequence:CCGGCCTGGAATGTAAGCATGGATACTCGAGTATCCATGCTTACATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144640
IL17RE MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1119s1c1
Sequence:CCGGGCTCTGCTTCAAGTTCTCTTTCTCGAGAAAGAGAACTTGAAGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-583s1c1
Sequence:CCGGCCAGAGACATGGGAAAGTCTTCTCGAGAAGACTTTCCCATGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1351s1c1
Sequence:CCGGGTGTCACTAGACCTCATCATTCTCGAGAATGATGAGGTCTAGTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-249s1c1
Sequence:CCGGCACTGGAAGTTCTGCCTATATCTCGAGATATAGGCAGAACTTCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144640.2-1190s1c1
Sequence:CCGGCCTGGAATGTAAGCATGGATACTCGAGTATCCATGCTTACATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)