EMAIL THIS PAGE TO A FRIEND

IL17REL

interleukin 17 receptor E-like

20 Gene Product Result for
UniProtKB ID: Q6ZVW7, A6NCN4, A6PVC1
Gene ID:
sheep(101113671) interleukin 17 receptor E-like
chicken(769256) interleukin 17 receptor E-like
cow(100336471) interleukin 17 receptor E-like
dog(607159) interleukin 17 receptor E-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001694 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001694 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155149 predicted 652
2 SASI_Hs01_00155150 predicted 1732
3 SASI_Hs01_00155151 predicted 500
4 SASI_Hs01_00155153 predicted 1475
5 SASI_Hs01_00155154 predicted 1705
6 SASI_Hs01_00155155 predicted 1324
7 SASI_Hs01_00155157 predicted 1517
8 SASI_Hs01_00155158 predicted 1615
9 SASI_Hs01_00155152 predicted 1724
10 SASI_Hs01_00155156 predicted 1663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001694
IL17REL MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor E-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-3219s1c1
Sequence:CCGGGATGTGCGGTTCTCAGACATTCTCGAGAATGTCTGAGAACCGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-3232s1c1
Sequence:CCGGCAGACATTCCAAGTGGCACATCTCGAGATGTGCCACTTGGAATGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-2573s1c1
Sequence:CCGGGAATCTCCTCACGAACAAGTACTCGAGTACTTGTTCGTGAGGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001694.1-1042s1c1
Sequence:CCGGGCCTGAAGTTCTCTACCAGTTCTCGAGAACTGGTAGAGAACTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-2155s1c1
Sequence:CCGGCTCCAGCAGATCACAGACTAACTCGAGTTAGTCTGTGATCTGCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001694.2-511s21c1
Sequence:CCGGGAGGACCATCCCTCATTTCTGCTCGAGCAGAAATGAGGGATGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001694.2-1657s21c1
Sequence:CCGGGTGACTTGGGATGTCCCTTTGCTCGAGCAAAGGGACATCCCAAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001694
IL17REL MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor E-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-3219s1c1
Sequence:CCGGGATGTGCGGTTCTCAGACATTCTCGAGAATGTCTGAGAACCGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-3232s1c1
Sequence:CCGGCAGACATTCCAAGTGGCACATCTCGAGATGTGCCACTTGGAATGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-2573s1c1
Sequence:CCGGGAATCTCCTCACGAACAAGTACTCGAGTACTTGTTCGTGAGGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001694.1-1042s1c1
Sequence:CCGGGCCTGAAGTTCTCTACCAGTTCTCGAGAACTGGTAGAGAACTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-2155s1c1
Sequence:CCGGCTCCAGCAGATCACAGACTAACTCGAGTTAGTCTGTGATCTGCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001694.2-511s21c1
Sequence:CCGGGAGGACCATCCCTCATTTCTGCTCGAGCAGAAATGAGGGATGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001694.2-1657s21c1
Sequence:CCGGGTGACTTGGGATGTCCCTTTGCTCGAGCAAAGGGACATCCCAAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001694
IL17REL MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor E-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-3219s1c1
Sequence:CCGGGATGTGCGGTTCTCAGACATTCTCGAGAATGTCTGAGAACCGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-3232s1c1
Sequence:CCGGCAGACATTCCAAGTGGCACATCTCGAGATGTGCCACTTGGAATGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-2573s1c1
Sequence:CCGGGAATCTCCTCACGAACAAGTACTCGAGTACTTGTTCGTGAGGAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001694.1-1042s1c1
Sequence:CCGGGCCTGAAGTTCTCTACCAGTTCTCGAGAACTGGTAGAGAACTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001694.1-2155s1c1
Sequence:CCGGCTCCAGCAGATCACAGACTAACTCGAGTTAGTCTGTGATCTGCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001694.2-511s21c1
Sequence:CCGGGAGGACCATCCCTCATTTCTGCTCGAGCAGAAATGAGGGATGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001694.2-1657s21c1
Sequence:CCGGGTGACTTGGGATGTCCCTTTGCTCGAGCAAAGGGACATCCCAAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)