EMAIL THIS PAGE TO A FRIEND

IL18

interleukin 18 (interferon-gamma-inducing factor)

64 Gene Product Result for
Synonyms: IGIF IL-18 IL-1g IL1F4
UniProtKB ID: Q14116, O75599, Q6FGY3, Q6WWJ7
Gene ID:
Human(3606) Summary: The protein encoded by this gene is a proinflammatory cytokine that augments natural killer cell activity in spleen cells, and stimulates interferon gamma production in T-helper type I cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Mouse(16173) interleukin 18
Rat(29197) interleukin 18
chicken(395312) interleukin 18 (interferon-gamma-inducing factor)
cow(281249) interleukin 18 (interferon-gamma-inducing factor)
Horse(100034216) interleukin 18 (interferon-gamma-inducing factor)
domestic cat(493688) interleukin 18 (interferon-gamma-inducing factor)
dog(403796) interleukin 18 (interferon-gamma-inducing factor)
Goat(100861190) interleukin 18 (interferon-gamma-inducing factor)
sheep(443206) interleukin 18 (interferon-gamma-inducing factor)
Domestic Rabbit(100144338) interleukin 18 (interferon-gamma-inducing factor)
naked mole-rat(101702804) interleukin 18 (interferon-gamma-inducing factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001562 Rosetta Predictions human pricing
NM_019165 Rosetta Predictions rat pricing
NM_008360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140127 predicted 256
2 SASI_Hs01_00140128 predicted 426
3 SASI_Hs01_00140129 predicted 258
4 SASI_Hs01_00140130 predicted 494
5 SASI_Hs01_00140131 predicted 493
6 SASI_Hs01_00140132 predicted 509
7 SASI_Hs01_00140133 predicted 502
8 SASI_Hs01_00140134 predicted 285
9 SASI_Hs01_00140135 predicted 500
10 SASI_Hs01_00140136 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083291 predicted 443
2 SASI_Rn02_00261951 predicted 359
3 SASI_Rn02_00261952 predicted 241
4 SASI_Rn01_00083294 predicted 291
5 SASI_Rn01_00083295 predicted 394
6 SASI_Rn01_00083296 predicted 242
7 SASI_Rn01_00083297 predicted 457
8 SASI_Rn01_00083298 predicted 231
9 SASI_Rn01_00083300 predicted 228
10 SASI_Rn02_00261953 predicted 256
11 SASI_Rn01_00083292 predicted 471
12 SASI_Rn01_00083293 predicted 497
13 SASI_Rn01_00083299 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161032 predicted 399
2 SASI_Mm01_00161033 predicted 351
3 SASI_Mm02_00313714 predicted 398
4 SASI_Mm01_00161034 predicted 219
5 SASI_Mm01_00161036 predicted 388
6 SASI_Mm01_00161037 predicted 316
7 SASI_Mm01_00161038 predicted 419
8 SASI_Mm01_00161039 predicted 280
9 SASI_Mm01_00161040 predicted 197
10 SASI_Mm01_00161041 predicted 314
11 SASI_Mm01_00161035 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001562
IL18 MISSION shRNA Bacterial Glycerol Stock
interleukin 18 (interferon-gamma-inducing factor)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001562.2-334s21c1
Sequence:CCGGTGGCAAGCTTGAATCTAAATTCTCGAGAATTTAGATTCAAGCTTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001562.2-430s21c1
Sequence:CCGGTGATTCTGACTGTAGAGATAACTCGAGTTATCTCTACAGTCAGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-590s1c1
Sequence:CCGGCCTCCTGATAACATCAAGGATCTCGAGATCCTTGATGTTATCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-456s1c1
Sequence:CCGGCCCGGACCATATTTATTATAACTCGAGTTATAATAAATATGGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-646s1c1
Sequence:CCGGCCCAGGACATGATAATAAGATCTCGAGATCTTATTATCATGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-693s1c1
Sequence:CCGGGATACTTTCTAGCTTGTGAAACTCGAGTTTCACAAGCTAGAAAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-380s1c1
Sequence:CCGGCAAGTTCTCTTCATTGACCAACTCGAGTTGGTCAATGAAGAGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001562
IL18 MISSION shRNA shRNA Plasmid DNA
interleukin 18 (interferon-gamma-inducing factor)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001562.2-334s21c1
Sequence:CCGGTGGCAAGCTTGAATCTAAATTCTCGAGAATTTAGATTCAAGCTTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001562.2-430s21c1
Sequence:CCGGTGATTCTGACTGTAGAGATAACTCGAGTTATCTCTACAGTCAGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-590s1c1
Sequence:CCGGCCTCCTGATAACATCAAGGATCTCGAGATCCTTGATGTTATCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-456s1c1
Sequence:CCGGCCCGGACCATATTTATTATAACTCGAGTTATAATAAATATGGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-646s1c1
Sequence:CCGGCCCAGGACATGATAATAAGATCTCGAGATCTTATTATCATGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-693s1c1
Sequence:CCGGGATACTTTCTAGCTTGTGAAACTCGAGTTTCACAAGCTAGAAAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-380s1c1
Sequence:CCGGCAAGTTCTCTTCATTGACCAACTCGAGTTGGTCAATGAAGAGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001562
IL18 MISSION shRNA Lentiviral Transduction Particles
interleukin 18 (interferon-gamma-inducing factor)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001562.2-334s21c1
Sequence:CCGGTGGCAAGCTTGAATCTAAATTCTCGAGAATTTAGATTCAAGCTTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001562.2-430s21c1
Sequence:CCGGTGATTCTGACTGTAGAGATAACTCGAGTTATCTCTACAGTCAGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-590s1c1
Sequence:CCGGCCTCCTGATAACATCAAGGATCTCGAGATCCTTGATGTTATCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-456s1c1
Sequence:CCGGCCCGGACCATATTTATTATAACTCGAGTTATAATAAATATGGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-646s1c1
Sequence:CCGGCCCAGGACATGATAATAAGATCTCGAGATCTTATTATCATGTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-693s1c1
Sequence:CCGGGATACTTTCTAGCTTGTGAAACTCGAGTTTCACAAGCTAGAAAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001562.2-380s1c1
Sequence:CCGGCAAGTTCTCTTCATTGACCAACTCGAGTTGGTCAATGAAGAGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008360
VALIDATED
IL18 MISSION shRNA Bacterial Glycerol Stock
interleukin 18 (interferon-gamma-inducing factor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-485s21c2
Sequence:CCGGCCTCTCCTGTAAGAACAAGATCTCGAGATCTTGTTCTTACAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-455s21c3
Sequence:CCGGCCTCTCTGTGAAGGATAGTAACTCGAGTTACTATCCTTCACAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-191s21c2
Sequence:CCGGCGTCAACTTCAAGGAAATGATCTCGAGATCATTTCCTTGAAGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-295s21c2
Sequence:CCGGCCGCAGTAATACGGAATATAACTCGAGTTATATTCCGTATTACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-660s1c1
Sequence:CCGGGCTTTCAAACTCATTCTGAAACTCGAGTTTCAGAATGAGTTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-660s21c1
Sequence:CCGGGCTTTCAAACTCATTCTGAAACTCGAGTTTCAGAATGAGTTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-295s1c1
Sequence:CCGGCCGCAGTAATACGGAATATAACTCGAGTTATATTCCGTATTACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-191s1c1
Sequence:CCGGCGTCAACTTCAAGGAAATGATCTCGAGATCATTTCCTTGAAGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008360.1-455s1c1
Sequence:CCGGCCTCTCTGTGAAGGATAGTAACTCGAGTTACTATCCTTCACAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-485s1c1
Sequence:CCGGCCTCTCCTGTAAGAACAAGATCTCGAGATCTTGTTCTTACAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008360
VALIDATED
IL18 MISSION shRNA shRNA Plasmid DNA
interleukin 18 (interferon-gamma-inducing factor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-485s21c2
Sequence:CCGGCCTCTCCTGTAAGAACAAGATCTCGAGATCTTGTTCTTACAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-455s21c3
Sequence:CCGGCCTCTCTGTGAAGGATAGTAACTCGAGTTACTATCCTTCACAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-191s21c2
Sequence:CCGGCGTCAACTTCAAGGAAATGATCTCGAGATCATTTCCTTGAAGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-295s21c2
Sequence:CCGGCCGCAGTAATACGGAATATAACTCGAGTTATATTCCGTATTACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-660s1c1
Sequence:CCGGGCTTTCAAACTCATTCTGAAACTCGAGTTTCAGAATGAGTTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-660s21c1
Sequence:CCGGGCTTTCAAACTCATTCTGAAACTCGAGTTTCAGAATGAGTTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-295s1c1
Sequence:CCGGCCGCAGTAATACGGAATATAACTCGAGTTATATTCCGTATTACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-191s1c1
Sequence:CCGGCGTCAACTTCAAGGAAATGATCTCGAGATCATTTCCTTGAAGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008360.1-455s1c1
Sequence:CCGGCCTCTCTGTGAAGGATAGTAACTCGAGTTACTATCCTTCACAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-485s1c1
Sequence:CCGGCCTCTCCTGTAAGAACAAGATCTCGAGATCTTGTTCTTACAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008360
VALIDATED
IL18 MISSION shRNA Lentiviral Transduction Particles
interleukin 18 (interferon-gamma-inducing factor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-485s21c2
Sequence:CCGGCCTCTCCTGTAAGAACAAGATCTCGAGATCTTGTTCTTACAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-455s21c3
Sequence:CCGGCCTCTCTGTGAAGGATAGTAACTCGAGTTACTATCCTTCACAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-191s21c2
Sequence:CCGGCGTCAACTTCAAGGAAATGATCTCGAGATCATTTCCTTGAAGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-295s21c2
Sequence:CCGGCCGCAGTAATACGGAATATAACTCGAGTTATATTCCGTATTACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-660s1c1
Sequence:CCGGGCTTTCAAACTCATTCTGAAACTCGAGTTTCAGAATGAGTTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008360.1-660s21c1
Sequence:CCGGGCTTTCAAACTCATTCTGAAACTCGAGTTTCAGAATGAGTTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-295s1c1
Sequence:CCGGCCGCAGTAATACGGAATATAACTCGAGTTATATTCCGTATTACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-191s1c1
Sequence:CCGGCGTCAACTTCAAGGAAATGATCTCGAGATCATTTCCTTGAAGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008360.1-455s1c1
Sequence:CCGGCCTCTCTGTGAAGGATAGTAACTCGAGTTACTATCCTTCACAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008360.1-485s1c1
Sequence:CCGGCCTCTCCTGTAAGAACAAGATCTCGAGATCTTGTTCTTACAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)