EMAIL THIS PAGE TO A FRIEND

IL18BP

interleukin 18 binding protein

128 Gene Product Result for
Synonyms: IL18BPa
Gene ID:
Human(10068) Summary: The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Mouse(16068) interleukin 18 binding protein
Rat(84388) interleukin 18 binding protein
domestic guinea pig(100714819) interleukin 18 binding protein
naked mole-rat(101721919) interleukin 18 binding protein
sheep(101118983) interleukin 18 binding protein
cow(617470) interleukin 18 binding protein
domestic cat(101096599) interleukin 18 binding protein
dog(476818) interleukin 18 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173042 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039659 Rosetta Predictions human pricing
NM_001039660 Rosetta Predictions human pricing
NM_173042 Rosetta Predictions human pricing
NM_053374 Rosetta Predictions rat pricing
NM_010531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161669 predicted 1124
2 SASI_Hs01_00161670 predicted 581
3 SASI_Hs01_00161671 predicted 1152
4 SASI_Hs01_00161672 predicted 1145
5 SASI_Hs01_00161673 predicted 461
6 SASI_Hs01_00161674 predicted 582
7 SASI_Hs01_00161675 predicted 455
8 SASI_Hs02_00308623 predicted 1121
9 SASI_Hs01_00161677 predicted 494
10 SASI_Hs01_00161678 predicted 488
11 SASI_Hs01_00161676 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201481 predicted 1007
2 SASI_Hs01_00201482 predicted 1040
3 SASI_Hs01_00201483 predicted 901
4 SASI_Hs02_00308624 predicted 972
5 SASI_Hs02_00308625 predicted 728
6 SASI_Hs01_00201485 predicted 470
7 SASI_Hs01_00201486 predicted 350
8 SASI_Hs01_00201487 predicted 1046
9 SASI_Hs01_00201488 predicted 896
10 SASI_Hs01_00201490 predicted 385
11 SASI_Hs01_00201484 predicted 961
12 SASI_Hs01_00201489 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164106 predicted 1763
2 SASI_Hs01_00164107 predicted 1220
3 SASI_Hs01_00164108 predicted 1799
4 SASI_Hs01_00164109 predicted 1794
5 SASI_Hs01_00164110 predicted 1107
6 SASI_Hs01_00164111 predicted 1218
7 SASI_Hs01_00164112 predicted 1103
8 SASI_Hs02_00368038 predicted 1766
9 SASI_Hs01_00164114 predicted 1134
10 SASI_Hs01_00164115 predicted 1135
11 SASI_Hs01_00164113 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085902 predicted 222
2 SASI_Rn01_00085903 predicted 367
3 SASI_Rn01_00085904 predicted 232
4 SASI_Rn01_00085905 predicted 203
5 SASI_Rn01_00085906 predicted 347
6 SASI_Rn01_00085907 predicted 338
7 SASI_Rn01_00085908 predicted 224
8 SASI_Rn01_00085910 predicted 215
9 SASI_Rn01_00085911 predicted 333
10 SASI_Rn02_00265860 predicted 332
11 SASI_Rn01_00085909 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045364 predicted 259
2 SASI_Mm01_00045365 predicted 566
3 SASI_Mm02_00318793 predicted 225
4 SASI_Mm01_00045367 predicted 862
5 SASI_Mm01_00045368 predicted 1013
6 SASI_Mm01_00045369 predicted 1087
7 SASI_Mm01_00045370 predicted 836
8 SASI_Mm01_00045371 predicted 1117
9 SASI_Mm01_00045372 predicted 861
10 SASI_Mm01_00045373 predicted 999
11 SASI_Mm01_00045366 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005699
IL18BP MISSION shRNA Bacterial Glycerol Stock
interleukin 18 binding protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1345s1c1
Sequence:CCGGTGCCCTGCACAGCACCAACTTCTCGAGAAGTTGGTGCTGTGCAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1223s1c1
Sequence:CCGGCTGGGCAATGGTTCCTTCATTCTCGAGAATGAAGGAACCATTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1044s1c1
Sequence:CCGGCTGCCTCAGTTAGAAGCACAACTCGAGTTGTGCTTCTAACTGAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1087s1c1
Sequence:CCGGCCCAGTGTTCCCAGCAGCTAACTCGAGTTAGCTGCTGGGAACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1143s1c1
Sequence:CCGGTGGAAGTGCCACTGAATGGAACTCGAGTTCCATTCAGTGGCACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005699
IL18BP MISSION shRNA shRNA Plasmid DNA
interleukin 18 binding protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1345s1c1
Sequence:CCGGTGCCCTGCACAGCACCAACTTCTCGAGAAGTTGGTGCTGTGCAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1223s1c1
Sequence:CCGGCTGGGCAATGGTTCCTTCATTCTCGAGAATGAAGGAACCATTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1044s1c1
Sequence:CCGGCTGCCTCAGTTAGAAGCACAACTCGAGTTGTGCTTCTAACTGAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1087s1c1
Sequence:CCGGCCCAGTGTTCCCAGCAGCTAACTCGAGTTAGCTGCTGGGAACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1143s1c1
Sequence:CCGGTGGAAGTGCCACTGAATGGAACTCGAGTTCCATTCAGTGGCACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005699
IL18BP MISSION shRNA Lentiviral Transduction Particles
interleukin 18 binding protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1345s1c1
Sequence:CCGGTGCCCTGCACAGCACCAACTTCTCGAGAAGTTGGTGCTGTGCAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1223s1c1
Sequence:CCGGCTGGGCAATGGTTCCTTCATTCTCGAGAATGAAGGAACCATTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1044s1c1
Sequence:CCGGCTGCCTCAGTTAGAAGCACAACTCGAGTTGTGCTTCTAACTGAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1087s1c1
Sequence:CCGGCCCAGTGTTCCCAGCAGCTAACTCGAGTTAGCTGCTGGGAACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005699.2-1143s1c1
Sequence:CCGGTGGAAGTGCCACTGAATGGAACTCGAGTTCCATTCAGTGGCACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010531
IL18BP MISSION shRNA Bacterial Glycerol Stock
interleukin 18 binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-669s1c1
Sequence:CCGGCTTCTCAAGAAACCCTCTCTACTCGAGTAGAGAGGGTTTCTTGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-234s1c1
Sequence:CCGGCCACATCTGCACCTCAGACAACTCGAGTTGTCTGAGGTGCAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-258s1c1
Sequence:CCGGCCACTGTCTTAACTGGAAGCTCTCGAGAGCTTCCAGTTAAGACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-561s1c1
Sequence:CCGGCCCTACGAAGTACCAACTTCTCTCGAGAGAAGTTGGTACTTCGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-336s1c1
Sequence:CCGGTGGATGTGATTTGGCCAGAAACTCGAGTTTCTGGCCAAATCACATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010531
IL18BP MISSION shRNA shRNA Plasmid DNA
interleukin 18 binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-669s1c1
Sequence:CCGGCTTCTCAAGAAACCCTCTCTACTCGAGTAGAGAGGGTTTCTTGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-234s1c1
Sequence:CCGGCCACATCTGCACCTCAGACAACTCGAGTTGTCTGAGGTGCAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-258s1c1
Sequence:CCGGCCACTGTCTTAACTGGAAGCTCTCGAGAGCTTCCAGTTAAGACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-561s1c1
Sequence:CCGGCCCTACGAAGTACCAACTTCTCTCGAGAGAAGTTGGTACTTCGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-336s1c1
Sequence:CCGGTGGATGTGATTTGGCCAGAAACTCGAGTTTCTGGCCAAATCACATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010531
IL18BP MISSION shRNA Lentiviral Transduction Particles
interleukin 18 binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-669s1c1
Sequence:CCGGCTTCTCAAGAAACCCTCTCTACTCGAGTAGAGAGGGTTTCTTGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-234s1c1
Sequence:CCGGCCACATCTGCACCTCAGACAACTCGAGTTGTCTGAGGTGCAGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-258s1c1
Sequence:CCGGCCACTGTCTTAACTGGAAGCTCTCGAGAGCTTCCAGTTAAGACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-561s1c1
Sequence:CCGGCCCTACGAAGTACCAACTTCTCTCGAGAGAAGTTGGTACTTCGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010531.1-336s1c1
Sequence:CCGGTGGATGTGATTTGGCCAGAAACTCGAGTTTCTGGCCAAATCACATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173042
IL18BP MISSION shRNA Bacterial Glycerol Stock
interleukin 18 binding protein
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000372614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173042.2-1640s21c1
Sequence:CCGGGGTCCCTTCTCTCACCAAATTCTCGAGAATTTGGTGAGAGAAGGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173042.2-1902s21c1
Sequence:CCGGTCCCATGTCTCTGCTCATTTACTCGAGTAAATGAGCAGAGACATGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173042
IL18BP MISSION shRNA shRNA Plasmid DNA
interleukin 18 binding protein
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000372614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173042.2-1640s21c1
Sequence:CCGGGGTCCCTTCTCTCACCAAATTCTCGAGAATTTGGTGAGAGAAGGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173042.2-1902s21c1
Sequence:CCGGTCCCATGTCTCTGCTCATTTACTCGAGTAAATGAGCAGAGACATGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173042
IL18BP MISSION shRNA Lentiviral Transduction Particles
interleukin 18 binding protein
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000372614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173042.2-1640s21c1
Sequence:CCGGGGTCCCTTCTCTCACCAAATTCTCGAGAATTTGGTGAGAGAAGGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173042.2-1902s21c1
Sequence:CCGGTCCCATGTCTCTGCTCATTTACTCGAGTAAATGAGCAGAGACATGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)