EMAIL THIS PAGE TO A FRIEND

IL18R1

interleukin 18 receptor 1

65 Gene Product Result for
Synonyms: CD218a CDw218a IL-1Rrp IL18RA IL1RRP
UniProtKB ID: Q13478, B2R9Y5, Q52LC9
Gene ID:
Human(8809) Summary: The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. [provided by RefSeq, Jul 2008]
Mouse(16182) interleukin 18 receptor 1
Rat(301365) interleukin 18 receptor 1
chicken(418717) interleukin 18 receptor 1
domestic cat(493938) interleukin 18 receptor 1
cow(407221) interleukin 18 receptor 1
Horse(100058269) interleukin 18 receptor 1
dog(611438) interleukin 18 receptor 1
Goat(100861236) interleukin 18 receptor 1
Domestic Rabbit(100303768) interleukin 18 receptor 1
sheep(101102552) interleukin 18 receptor 1
domestic guinea pig(100725037) interleukin 18 receptor 1
naked mole-rat(101713207) interleukin 18 receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0691 Human Il18R1 / Interleukin-18 Receptor 1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003855 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088201 MISSION® esiRNA esiRNA human IL18R1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003855 Rosetta Predictions human pricing
NM_001106905 Rosetta Predictions rat pricing
NM_008365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336435 predicted 336
2 SASI_Hs01_00117228 predicted 466
3 SASI_Hs01_00117229 predicted 1249
4 SASI_Hs01_00117230 predicted 497
5 SASI_Hs01_00117231 predicted 478
6 SASI_Hs01_00117232 predicted 1530
7 SASI_Hs01_00117233 predicted 1007
8 SASI_Hs01_00117234 predicted 1330
9 SASI_Hs01_00117235 predicted 1363
10 SASI_Hs01_00117236 predicted 529
11 SASI_Hs01_00117237 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223556 predicted 1027
2 SASI_Rn02_00223557 predicted 836
3 SASI_Rn02_00223558 predicted 734
4 SASI_Rn02_00223559 predicted 1089
5 SASI_Rn02_00223560 predicted 402
6 SASI_Rn02_00223561 predicted 980
7 SASI_Rn02_00223562 predicted 902
8 SASI_Rn02_00223563 predicted 1575
9 SASI_Rn02_00223564 predicted 382
10 SASI_Rn02_00223565 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184846 predicted 782
2 SASI_Mm01_00184847 predicted 836
3 SASI_Mm01_00184848 predicted 828
4 SASI_Mm01_00184849 predicted 1039
5 SASI_Mm01_00184850 predicted 663
6 SASI_Mm01_00184851 predicted 1583
7 SASI_Mm01_00184853 predicted 1356
8 SASI_Mm02_00313720 predicted 1581
9 SASI_Mm01_00184854 predicted 691
10 SASI_Mm01_00184855 predicted 2012
11 SASI_Mm01_00184852 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003855
IL18R1 MISSION shRNA Bacterial Glycerol Stock
interleukin 18 receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003855.2-1722s21c1
Sequence:CCGGCAAAGGCTGTGACTCGAAATACTCGAGTATTTCGAGTCACAGCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003855.2-567s21c1
Sequence:CCGGGTATTACTCCTGCGTGCATTTCTCGAGAAATGCACGCAGGAGTAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003855.2-1763s1c1
Sequence:CCGGGCTCACAATTTGAAGATGAAACTCGAGTTTCATCTTCAAATTGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003855.2-882s21c1
Sequence:CCGGTATTGGTGAAAGCAATCTAAACTCGAGTTTAGATTGCTTTCACCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-1629s1c1
Sequence:CCGGGCCTGTTCTTTCCGAGTCTTACTCGAGTAAGACTCGGAAAGAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-245s1c1
Sequence:CCGGCGAGAATTGCTTTGCATGATTCTCGAGAATCATGCAAAGCAATTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-1528s1c1
Sequence:CCGGGCCGATAAATCTCTTTCTTATCTCGAGATAAGAAAGAGATTTATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-996s1c1
Sequence:CCGGCCACGTCTTCACAAGAGGAATCTCGAGATTCCTCTTGTGAAGACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003855
IL18R1 MISSION shRNA shRNA Plasmid DNA
interleukin 18 receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003855.2-1722s21c1
Sequence:CCGGCAAAGGCTGTGACTCGAAATACTCGAGTATTTCGAGTCACAGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003855.2-567s21c1
Sequence:CCGGGTATTACTCCTGCGTGCATTTCTCGAGAAATGCACGCAGGAGTAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003855.2-1763s1c1
Sequence:CCGGGCTCACAATTTGAAGATGAAACTCGAGTTTCATCTTCAAATTGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003855.2-882s21c1
Sequence:CCGGTATTGGTGAAAGCAATCTAAACTCGAGTTTAGATTGCTTTCACCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-1629s1c1
Sequence:CCGGGCCTGTTCTTTCCGAGTCTTACTCGAGTAAGACTCGGAAAGAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-245s1c1
Sequence:CCGGCGAGAATTGCTTTGCATGATTCTCGAGAATCATGCAAAGCAATTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-1528s1c1
Sequence:CCGGGCCGATAAATCTCTTTCTTATCTCGAGATAAGAAAGAGATTTATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-996s1c1
Sequence:CCGGCCACGTCTTCACAAGAGGAATCTCGAGATTCCTCTTGTGAAGACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003855
IL18R1 MISSION shRNA Lentiviral Transduction Particles
interleukin 18 receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003855.2-1722s21c1
Sequence:CCGGCAAAGGCTGTGACTCGAAATACTCGAGTATTTCGAGTCACAGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003855.2-567s21c1
Sequence:CCGGGTATTACTCCTGCGTGCATTTCTCGAGAAATGCACGCAGGAGTAATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003855.2-1763s1c1
Sequence:CCGGGCTCACAATTTGAAGATGAAACTCGAGTTTCATCTTCAAATTGTGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003855.2-882s21c1
Sequence:CCGGTATTGGTGAAAGCAATCTAAACTCGAGTTTAGATTGCTTTCACCAATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-1629s1c1
Sequence:CCGGGCCTGTTCTTTCCGAGTCTTACTCGAGTAAGACTCGGAAAGAACAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-245s1c1
Sequence:CCGGCGAGAATTGCTTTGCATGATTCTCGAGAATCATGCAAAGCAATTCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-1528s1c1
Sequence:CCGGGCCGATAAATCTCTTTCTTATCTCGAGATAAGAAAGAGATTTATCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003855.2-996s1c1
Sequence:CCGGCCACGTCTTCACAAGAGGAATCTCGAGATTCCTCTTGTGAAGACGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008365
IL18R1 MISSION shRNA Bacterial Glycerol Stock
interleukin 18 receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1469s1c1
Sequence:CCGGCGAGACACTAACAGATGGTAACTCGAGTTACCATCTGTTAGTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-559s1c1
Sequence:CCGGGCAGTGCTTCACATGAGTATACTCGAGTATACTCATGTGAAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1086s1c1
Sequence:CCGGGCTTCATTGAATAAAGACGATCTCGAGATCGTCTTTATTCAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1530s1c1
Sequence:CCGGCCTGAGAATAAAGAAGAGTATCTCGAGATACTCTTCTTTATTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-453s1c1
Sequence:CCGGCGATCACAAATTCATGTGGTACTCGAGTACCACATGAATTTGTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008365
IL18R1 MISSION shRNA shRNA Plasmid DNA
interleukin 18 receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1469s1c1
Sequence:CCGGCGAGACACTAACAGATGGTAACTCGAGTTACCATCTGTTAGTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-559s1c1
Sequence:CCGGGCAGTGCTTCACATGAGTATACTCGAGTATACTCATGTGAAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1086s1c1
Sequence:CCGGGCTTCATTGAATAAAGACGATCTCGAGATCGTCTTTATTCAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1530s1c1
Sequence:CCGGCCTGAGAATAAAGAAGAGTATCTCGAGATACTCTTCTTTATTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-453s1c1
Sequence:CCGGCGATCACAAATTCATGTGGTACTCGAGTACCACATGAATTTGTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008365
IL18R1 MISSION shRNA Lentiviral Transduction Particles
interleukin 18 receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1469s1c1
Sequence:CCGGCGAGACACTAACAGATGGTAACTCGAGTTACCATCTGTTAGTGTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-559s1c1
Sequence:CCGGGCAGTGCTTCACATGAGTATACTCGAGTATACTCATGTGAAGCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1086s1c1
Sequence:CCGGGCTTCATTGAATAAAGACGATCTCGAGATCGTCTTTATTCAATGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-1530s1c1
Sequence:CCGGCCTGAGAATAAAGAAGAGTATCTCGAGATACTCTTCTTTATTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008365.1-453s1c1
Sequence:CCGGCGATCACAAATTCATGTGGTACTCGAGTACCACATGAATTTGTGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)