EMAIL THIS PAGE TO A FRIEND

IL18RAP

interleukin 18 receptor accessory protein

53 Gene Product Result for
Synonyms: ACPL CD218b CDw218b IL18RB
UniProtKB ID: O95256, B2RPJ3, Q3KPE7, Q53TT4, Q53TU5
Gene ID:
Human(8807) Summary: The protein encoded by this gene is an accessory subunit of the heterodimeric receptor for IL18. This protein enhances the IL18 binding activity of IL18R1 (IL1RRP), a ligand binding subunit of IL18 receptor. The coexpression of IL18R1 and this protein is required for the activation of NF-kappaB and MAPK8 (JNK) in response to IL18. [provided by RefSeq, Jul 2008]
Mouse(16174) interleukin 18 receptor accessory protein
Rat(373540) interleukin 18 receptor accessory protein
domestic guinea pig(100730828) interleukin 18 receptor accessory protein
naked mole-rat(101721095) interleukin 18 receptor accessory protein
sheep(101109262) interleukin 18 receptor accessory protein
chicken(770782) interleukin 18 receptor accessory protein
cow(493716) interleukin 18 receptor accessory protein
Horse(100050212) interleukin 18 receptor accessory protein
domestic cat(101084868) interleukin 18 receptor accessory protein
dog(481327) interleukin 18 receptor accessory protein
chicken(101750396) interleukin 18 receptor accessory protein
chicken(101667217) interleukin 18 receptor accessory protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003853 Rosetta Predictions human pricing
NM_184047 Rosetta Predictions rat pricing
NM_010553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163554 predicted 1433
2 SASI_Hs01_00163555 predicted 1415
3 SASI_Hs01_00163557 predicted 2198
4 SASI_Hs01_00163558 predicted 2089
5 SASI_Hs01_00163559 predicted 1865
6 SASI_Hs01_00163560 predicted 1206
7 SASI_Hs02_00336430 predicted 1308
8 SASI_Hs01_00163561 predicted 1348
9 SASI_Hs02_00336431 predicted 1300
10 SASI_Hs02_00336432 predicted 1704
11 SASI_Hs01_00163556 predicted 1949
12 SASI_Hs01_00163562 predicted 1315
13 SASI_Hs01_00163563 predicted 1995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075102 predicted 235
2 SASI_Rn01_00075103 predicted 276
3 SASI_Rn01_00075104 predicted 315
4 SASI_Rn01_00075105 predicted 275
5 SASI_Rn01_00075106 predicted 263
6 SASI_Rn01_00075107 predicted 297
7 SASI_Rn02_00269903 predicted 214
8 SASI_Rn01_00075108 predicted 279
9 SASI_Rn01_00075109 predicted 217
10 SASI_Rn01_00075110 predicted 218
11 SASI_Rn01_00075111 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142538 predicted 475
2 SASI_Mm01_00142539 predicted 1178
3 SASI_Mm01_00142540 predicted 1641
4 SASI_Mm01_00142541 predicted 1344
5 SASI_Mm01_00142542 predicted 1582
6 SASI_Mm02_00318818 predicted 654
7 SASI_Mm01_00142543 predicted 1667
8 SASI_Mm01_00142544 predicted 1903
9 SASI_Mm01_00142546 predicted 1381
10 SASI_Mm01_00142547 predicted 487
11 SASI_Mm01_00142545 predicted 1613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003853
IL18RAP MISSION shRNA Bacterial Glycerol Stock
interleukin 18 receptor accessory protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-1949s1c1
Sequence:CCGGCCCAGTATCTTTGAACTACAACTCGAGTTGTAGTTCAAAGATACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003853.2-2483s1c1
Sequence:CCGGCGAGTGAATTCTCTAGACCTTCTCGAGAAGGTCTAGAGAATTCACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-1286s1c1
Sequence:CCGGCCTTTAACTATTAGCTGCAAACTCGAGTTTGCAGCTAATAGTTAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-896s1c1
Sequence:CCGGGCCTGTTGTGTCAAGATGATTCTCGAGAATCATCTTGACACAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-2197s1c1
Sequence:CCGGGCTCAGAATTACCTCTAGGATCTCGAGATCCTAGAGGTAATTCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-1426s21c1
Sequence:CCGGTGAAATCATTGAGCGTAATATCTCGAGATATTACGCTCAATGATTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-838s21c1
Sequence:CCGGGAATAATTCTGGGTCATATATCTCGAGATATATGACCCAGAATTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-1224s21c1
Sequence:CCGGCTAAACTCAAACCAGATATTCCTCGAGGAATATCTGGTTTGAGTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003853
IL18RAP MISSION shRNA shRNA Plasmid DNA
interleukin 18 receptor accessory protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-1949s1c1
Sequence:CCGGCCCAGTATCTTTGAACTACAACTCGAGTTGTAGTTCAAAGATACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003853.2-2483s1c1
Sequence:CCGGCGAGTGAATTCTCTAGACCTTCTCGAGAAGGTCTAGAGAATTCACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-1286s1c1
Sequence:CCGGCCTTTAACTATTAGCTGCAAACTCGAGTTTGCAGCTAATAGTTAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-896s1c1
Sequence:CCGGGCCTGTTGTGTCAAGATGATTCTCGAGAATCATCTTGACACAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-2197s1c1
Sequence:CCGGGCTCAGAATTACCTCTAGGATCTCGAGATCCTAGAGGTAATTCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-1426s21c1
Sequence:CCGGTGAAATCATTGAGCGTAATATCTCGAGATATTACGCTCAATGATTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-838s21c1
Sequence:CCGGGAATAATTCTGGGTCATATATCTCGAGATATATGACCCAGAATTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-1224s21c1
Sequence:CCGGCTAAACTCAAACCAGATATTCCTCGAGGAATATCTGGTTTGAGTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003853
IL18RAP MISSION shRNA Lentiviral Transduction Particles
interleukin 18 receptor accessory protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-1949s1c1
Sequence:CCGGCCCAGTATCTTTGAACTACAACTCGAGTTGTAGTTCAAAGATACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003853.2-2483s1c1
Sequence:CCGGCGAGTGAATTCTCTAGACCTTCTCGAGAAGGTCTAGAGAATTCACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-1286s1c1
Sequence:CCGGCCTTTAACTATTAGCTGCAAACTCGAGTTTGCAGCTAATAGTTAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-896s1c1
Sequence:CCGGGCCTGTTGTGTCAAGATGATTCTCGAGAATCATCTTGACACAACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003853.2-2197s1c1
Sequence:CCGGGCTCAGAATTACCTCTAGGATCTCGAGATCCTAGAGGTAATTCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-1426s21c1
Sequence:CCGGTGAAATCATTGAGCGTAATATCTCGAGATATTACGCTCAATGATTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-838s21c1
Sequence:CCGGGAATAATTCTGGGTCATATATCTCGAGATATATGACCCAGAATTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003853.2-1224s21c1
Sequence:CCGGCTAAACTCAAACCAGATATTCCTCGAGGAATATCTGGTTTGAGTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010553
VALIDATED
IL18RAP MISSION shRNA Bacterial Glycerol Stock
interleukin 18 receptor accessory protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010553.1-2308s1c1
Sequence:CCGGGCTGATAGAAATTGAGCCTTTCTCGAGAAAGGCTCAATTTCTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-789s1c1
Sequence:CCGGCGAACAGCATTTGGTCATATACTCGAGTATATGACCAAATGCTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-908s1c1
Sequence:CCGGGCACAAGATGAACAAGTCCTACTCGAGTAGGACTTGTTCATCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-1171s1c1
Sequence:CCGGCATCAATGTGAAGCCGGAAATCTCGAGATTTCCGGCTTCACATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-1388s1c1
Sequence:CCGGCGTACCATCTTCTTGAGAGAACTCGAGTTCTCTCAAGAAGATGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1663s21c1
Sequence:CCGGATTTGTATCCTACTCGAATTGCTCGAGCAATTCGAGTAGGATACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1047s21c1
Sequence:CCGGCAATTGAGATGGCAGATATTTCTCGAGAAATATCTGCCATCTCAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1171s21c1
Sequence:CCGGCATCAATGTGAAGCCGGAAATCTCGAGATTTCCGGCTTCACATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010553.2-2308s21c1
Sequence:CCGGGCTGATAGAAATTGAGCCTTTCTCGAGAAAGGCTCAATTTCTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-756s21c1
Sequence:CCGGGTGAAGGCATGCTGCATATATCTCGAGATATATGCAGCATGCCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010553
VALIDATED
IL18RAP MISSION shRNA shRNA Plasmid DNA
interleukin 18 receptor accessory protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010553.1-2308s1c1
Sequence:CCGGGCTGATAGAAATTGAGCCTTTCTCGAGAAAGGCTCAATTTCTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-789s1c1
Sequence:CCGGCGAACAGCATTTGGTCATATACTCGAGTATATGACCAAATGCTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-908s1c1
Sequence:CCGGGCACAAGATGAACAAGTCCTACTCGAGTAGGACTTGTTCATCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-1171s1c1
Sequence:CCGGCATCAATGTGAAGCCGGAAATCTCGAGATTTCCGGCTTCACATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-1388s1c1
Sequence:CCGGCGTACCATCTTCTTGAGAGAACTCGAGTTCTCTCAAGAAGATGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1663s21c1
Sequence:CCGGATTTGTATCCTACTCGAATTGCTCGAGCAATTCGAGTAGGATACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1047s21c1
Sequence:CCGGCAATTGAGATGGCAGATATTTCTCGAGAAATATCTGCCATCTCAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1171s21c1
Sequence:CCGGCATCAATGTGAAGCCGGAAATCTCGAGATTTCCGGCTTCACATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010553.2-2308s21c1
Sequence:CCGGGCTGATAGAAATTGAGCCTTTCTCGAGAAAGGCTCAATTTCTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-756s21c1
Sequence:CCGGGTGAAGGCATGCTGCATATATCTCGAGATATATGCAGCATGCCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010553
VALIDATED
IL18RAP MISSION shRNA Lentiviral Transduction Particles
interleukin 18 receptor accessory protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010553.1-2308s1c1
Sequence:CCGGGCTGATAGAAATTGAGCCTTTCTCGAGAAAGGCTCAATTTCTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-789s1c1
Sequence:CCGGCGAACAGCATTTGGTCATATACTCGAGTATATGACCAAATGCTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-908s1c1
Sequence:CCGGGCACAAGATGAACAAGTCCTACTCGAGTAGGACTTGTTCATCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-1171s1c1
Sequence:CCGGCATCAATGTGAAGCCGGAAATCTCGAGATTTCCGGCTTCACATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010553.1-1388s1c1
Sequence:CCGGCGTACCATCTTCTTGAGAGAACTCGAGTTCTCTCAAGAAGATGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1663s21c1
Sequence:CCGGATTTGTATCCTACTCGAATTGCTCGAGCAATTCGAGTAGGATACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1047s21c1
Sequence:CCGGCAATTGAGATGGCAGATATTTCTCGAGAAATATCTGCCATCTCAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-1171s21c1
Sequence:CCGGCATCAATGTGAAGCCGGAAATCTCGAGATTTCCGGCTTCACATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010553.2-2308s21c1
Sequence:CCGGGCTGATAGAAATTGAGCCTTTCTCGAGAAAGGCTCAATTTCTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010553.2-756s21c1
Sequence:CCGGGTGAAGGCATGCTGCATATATCTCGAGATATATGCAGCATGCCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)