EMAIL THIS PAGE TO A FRIEND

IL19

interleukin 19

70 Gene Product Result for
Synonyms: IL-10C MDA1 NG.1 ZMDA1
UniProtKB ID: Q9UHD0, Q5VUT3, Q96QR4, Q9NUA0
Gene ID:
Human(29949) Summary: The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(329244) interleukin 19
Rat(681145) interleukin 19
chicken(428265) interleukin 19
cow(527634) interleukin 19
domestic cat(101090582) interleukin 19
dog(490265) interleukin 19
sheep(101112663) interleukin 19
naked mole-rat(101725985) interleukin 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1519 Human IL-19 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_283649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013371 Rosetta Predictions human pricing
NM_153758 Rosetta Predictions human pricing
XM_001060482 Rosetta Predictions rat pricing
NM_001009940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199744 predicted 1451
2 SASI_Hs01_00199745 predicted 1261
3 SASI_Hs01_00199746 predicted 1597
4 SASI_Hs01_00199747 predicted 1180
5 SASI_Hs01_00199748 predicted 1165
6 SASI_Hs02_00344712 predicted 1431
7 SASI_Hs01_00199750 predicted 1128
8 SASI_Hs02_00344713 predicted 1424
9 SASI_Hs01_00199751 predicted 1151
10 SASI_Hs01_00199752 predicted 1199
11 SASI_Hs01_00199749 predicted 1338
12 SASI_Hs01_00199753 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218549 predicted 650
2 SASI_Hs01_00218550 predicted 455
3 SASI_Hs01_00218551 predicted 801
4 SASI_Hs01_00218552 predicted 386
5 SASI_Hs01_00218553 predicted 368
6 SASI_Hs02_00367468 predicted 629
7 SASI_Hs01_00218555 predicted 328
8 SASI_Hs02_00367469 predicted 619
9 SASI_Hs01_00218556 predicted 350
10 SASI_Hs01_00218557 predicted 400
11 SASI_Hs01_00218554 predicted 540
12 SASI_Hs01_00218558 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296660 predicted 195
2 SASI_Rn02_00296661 predicted 192
3 SASI_Rn02_00296662 predicted 306
4 SASI_Rn02_00296663 predicted 228
5 SASI_Rn02_00296664 predicted 197
6 SASI_Rn02_00296665 predicted 208
7 SASI_Rn02_00296666 predicted 226
8 SASI_Rn02_00296667 predicted 208
9 SASI_Rn02_00296668 predicted 216
10 SASI_Rn02_00296669 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073126 predicted 349
2 SASI_Mm01_00073128 predicted 279
3 SASI_Mm01_00073129 predicted 252
4 SASI_Mm01_00073130 predicted 235
5 SASI_Mm01_00073131 predicted 302
6 SASI_Mm01_00073133 predicted 302
7 SASI_Mm02_00286876 predicted 220
8 SASI_Mm01_00073134 predicted 204
9 SASI_Mm01_00073135 predicted 252
10 SASI_Mm02_00286877 predicted 319
11 SASI_Mm01_00073127 predicted 253
12 SASI_Mm01_00073132 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013371
IL19 MISSION shRNA Bacterial Glycerol Stock
interleukin 19
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013371.2-1471s21c1
Sequence:CCGGTGATGACAAGGAACCTGTATACTCGAGTATACAGGTTCCTTGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013371.2-1384s21c1
Sequence:CCGGGTCCACGCTGCTGCCATTAAACTCGAGTTTAATGGCAGCAGCGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1030s1c1
Sequence:CCGGTCCACAGACATGCACCATATACTCGAGTATATGGTGCATGTCTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1087s1c1
Sequence:CCGGGCTAAGGACACCTTCCCAAATCTCGAGATTTGGGAAGGTGTCCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-967s1c1
Sequence:CCGGCTCCTGGGTACAATACTGATACTCGAGTATCAGTATTGTACCCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1420s1c1
Sequence:CCGGGACGTCTTTCTAGCCTGGATTCTCGAGAATCCAGGCTAGAAAGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1138s1c1
Sequence:CCGGCAGATCATTAAGCCCTTAGATCTCGAGATCTAAGGGCTTAATGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013371
IL19 MISSION shRNA shRNA Plasmid DNA
interleukin 19
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013371.2-1471s21c1
Sequence:CCGGTGATGACAAGGAACCTGTATACTCGAGTATACAGGTTCCTTGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013371.2-1384s21c1
Sequence:CCGGGTCCACGCTGCTGCCATTAAACTCGAGTTTAATGGCAGCAGCGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1030s1c1
Sequence:CCGGTCCACAGACATGCACCATATACTCGAGTATATGGTGCATGTCTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1087s1c1
Sequence:CCGGGCTAAGGACACCTTCCCAAATCTCGAGATTTGGGAAGGTGTCCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-967s1c1
Sequence:CCGGCTCCTGGGTACAATACTGATACTCGAGTATCAGTATTGTACCCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1420s1c1
Sequence:CCGGGACGTCTTTCTAGCCTGGATTCTCGAGAATCCAGGCTAGAAAGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1138s1c1
Sequence:CCGGCAGATCATTAAGCCCTTAGATCTCGAGATCTAAGGGCTTAATGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013371
IL19 MISSION shRNA Lentiviral Transduction Particles
interleukin 19
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013371.2-1471s21c1
Sequence:CCGGTGATGACAAGGAACCTGTATACTCGAGTATACAGGTTCCTTGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013371.2-1384s21c1
Sequence:CCGGGTCCACGCTGCTGCCATTAAACTCGAGTTTAATGGCAGCAGCGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1030s1c1
Sequence:CCGGTCCACAGACATGCACCATATACTCGAGTATATGGTGCATGTCTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1087s1c1
Sequence:CCGGGCTAAGGACACCTTCCCAAATCTCGAGATTTGGGAAGGTGTCCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-967s1c1
Sequence:CCGGCTCCTGGGTACAATACTGATACTCGAGTATCAGTATTGTACCCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1420s1c1
Sequence:CCGGGACGTCTTTCTAGCCTGGATTCTCGAGAATCCAGGCTAGAAAGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013371.2-1138s1c1
Sequence:CCGGCAGATCATTAAGCCCTTAGATCTCGAGATCTAAGGGCTTAATGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283649
IL19 MISSION shRNA Bacterial Glycerol Stock
interleukin 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-616s1c1
Sequence:CCGGGCCTGGATTGACAGGAATCATCTCGAGATGATTCCTGTCAATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-322s1c1
Sequence:CCGGAGGAGCATTAAGCCTGGAGATCTCGAGATCTCCAGGCTTAATGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283649.2-962s1c1
Sequence:CCGGGCTGTGGTATTTATAGCAATACTCGAGTATTGCTATAAATACCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-270s1c1
Sequence:CCGGGCAAACTAAGGACACCTTTAACTCGAGTTAAAGGTGTCCTTAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-182s1c1
Sequence:CCGGCAGTTCATATCTACAGTCTTACTCGAGTAAGACTGTAGATATGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283649
IL19 MISSION shRNA shRNA Plasmid DNA
interleukin 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-616s1c1
Sequence:CCGGGCCTGGATTGACAGGAATCATCTCGAGATGATTCCTGTCAATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-322s1c1
Sequence:CCGGAGGAGCATTAAGCCTGGAGATCTCGAGATCTCCAGGCTTAATGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283649.2-962s1c1
Sequence:CCGGGCTGTGGTATTTATAGCAATACTCGAGTATTGCTATAAATACCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-270s1c1
Sequence:CCGGGCAAACTAAGGACACCTTTAACTCGAGTTAAAGGTGTCCTTAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-182s1c1
Sequence:CCGGCAGTTCATATCTACAGTCTTACTCGAGTAAGACTGTAGATATGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283649
IL19 MISSION shRNA Lentiviral Transduction Particles
interleukin 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-616s1c1
Sequence:CCGGGCCTGGATTGACAGGAATCATCTCGAGATGATTCCTGTCAATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-322s1c1
Sequence:CCGGAGGAGCATTAAGCCTGGAGATCTCGAGATCTCCAGGCTTAATGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283649.2-962s1c1
Sequence:CCGGGCTGTGGTATTTATAGCAATACTCGAGTATTGCTATAAATACCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-270s1c1
Sequence:CCGGGCAAACTAAGGACACCTTTAACTCGAGTTAAAGGTGTCCTTAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283649.2-182s1c1
Sequence:CCGGCAGTTCATATCTACAGTCTTACTCGAGTAAGACTGTAGATATGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)