EMAIL THIS PAGE TO A FRIEND

IL1A

interleukin 1, alpha

161 Gene Product Result for
Synonyms: IL-1A IL1 IL1-ALPHA IL1F1
UniProtKB ID: P01583, Q53QF9, Q7RU02
Gene ID:
Human(3552) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
Mouse(16175) interleukin 1 alpha
Rat(24493) interleukin 1 alpha
domestic guinea pig(100135555) interleukin 1, alpha
naked mole-rat(101703933) interleukin 1, alpha
Goat(100861289) interleukin 1, alpha
Domestic Rabbit(100009250) interleukin 1, alpha
sheep(443404) interleukin 1, alpha
cow(281250) interleukin 1, alpha
Horse(100064969) interleukin 1, alpha
dog(403782) interleukin 1, alpha
domestic cat(493944) interleukin 1, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108078 Anti-IL1A antibody produced in rabbit affinity isolated antibody horse, human, bovine, mouse
western blot pricing
AV54322 Anti-IL1A antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, bovine, horse, human
western blot pricing
HPA048546 Anti-IL1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1306019 ANTI-IL1A-S87 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW22493 Anti-Interleukin-1α antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
I3392 Anti-Interleukin-1α antibody produced in goat IgG fraction of antiserum, lyophilized powder mouse
ELISA, neutralization, western blot pricing
I8284 Anti-Interleukin-1α antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
I8534 Anti-Interleukin-1α antibody produced in goat affinity isolated antibody, lyophilized powder mouse
immunohistochemistry, neutralization, western blot pricing
I8909 Anti-Interleukin-1α antibody produced in goat IgG fraction of antiserum, lyophilized powder human
neutralization, western blot pricing
I5018 Anti-Interleukin-1α antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
dot blot, neutralization, radioimmunoassay pricing
I9034 Anti-Interleukin-1α propeptide antibody produced in sheep affinity isolated antibody, lyophilized powder human
flow cytometry, western blot pricing
WH0003552M1 Monoclonal Anti-IL1A antibody produced in mouse clone 4B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403967 Monoclonal Anti-IL1A, (C-terminal) antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
I7534 Monoclonal Anti-Interleukin-1α antibody produced in mouse clone 4414, purified immunoglobulin, lyophilized powder human
ELISA, immunohistochemistry, neutralization, western blot pricing
I7659 Monoclonal Anti-Interleukin-1α antibody produced in mouse clone 3405, purified immunoglobulin, lyophilized powder human
flow cytometry, neutralization pricing
I7409 Monoclonal Anti-Interleukin-1α propeptide antibody produced in mouse clone 409405, purified immunoglobulin, lyophilized powder human
western blot pricing
I8159 Monoclonal Anti-Interleukin-1α/Interleukin-1F1 antibody produced in rat clone 40508, purified immunoglobulin, lyophilized powder mouse
ELISA, neutralization pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
I7378 Indomethacin ≥99% (TLC) human, mouse, rat pricing
I8280 Indomethacin meets USP testing specifications human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000575 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150811 MISSION® esiRNA esiRNA human IL1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000575 Rosetta Predictions human pricing
NM_017019 Rosetta Predictions rat pricing
NM_010554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302829 predicted 1475
2 SASI_Hs01_00167954 predicted 1115
3 SASI_Hs01_00167956 predicted 1052
4 SASI_Hs01_00167960 predicted 1045
5 SASI_Hs01_00167961 predicted 1502
6 SASI_Hs02_00302830 predicted 1524
7 SASI_Hs02_00302831 predicted 1176
8 SASI_Hs02_00302832 predicted 1359
9 SASI_Hs02_00302833 predicted 1057
10 SASI_Hs02_00302834 predicted 1318
11 SASI_Hs01_00167952 predicted 1110
12 SASI_Hs01_00167953 predicted 971
13 SASI_Hs01_00167955 predicted 1125
14 SASI_Hs01_00167957 predicted 1644
15 SASI_Hs01_00167958 predicted 1798
16 SASI_Hs01_00167959 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048119 predicted 915
2 SASI_Rn01_00048120 predicted 469
3 SASI_Rn01_00048121 predicted 426
4 SASI_Rn01_00048122 predicted 850
5 SASI_Rn01_00048124 predicted 875
6 SASI_Rn01_00048125 predicted 461
7 SASI_Rn01_00048126 predicted 291
8 SASI_Rn01_00048127 predicted 518
9 SASI_Rn01_00048128 predicted 929
10 SASI_Rn02_00261186 predicted 618
11 SASI_Rn01_00048123 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185086 predicted 198
2 SASI_Mm01_00185087 predicted 878
3 SASI_Mm01_00185088 predicted 884
4 SASI_Mm01_00185089 predicted 591
5 SASI_Mm01_00185090 predicted 775
6 SASI_Mm01_00185091 predicted 406
7 SASI_Mm01_00185092 predicted 420
8 SASI_Mm01_00185093 predicted 272
9 SASI_Mm01_00185094 predicted 629
10 SASI_Mm01_00185095 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010554
IL1A MISSION shRNA Bacterial Glycerol Stock
interleukin 1, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010554.3-1782s1c1
Sequence:CCGGCCAACCATCTAAAGATGGAAACTCGAGTTTCCATCTTTAGATGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-114s1c1
Sequence:CCGGCGAAGACTACAGTTCTGCCATCTCGAGATGGCAGAACTGTAGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-595s1c1
Sequence:CCGGGACGACTCTAAATATCCTGTTCTCGAGAACAGGATATTTAGAGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-778s1c1
Sequence:CCGGGCTGCTTATCCAGAGCTGTTTCTCGAGAAACAGCTCTGGATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-420s1c1
Sequence:CCGGCCAGAGTGATTTGAGATACAACTCGAGTTGTATCTCAAATCACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010554
IL1A MISSION shRNA shRNA Plasmid DNA
interleukin 1, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010554.3-1782s1c1
Sequence:CCGGCCAACCATCTAAAGATGGAAACTCGAGTTTCCATCTTTAGATGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-114s1c1
Sequence:CCGGCGAAGACTACAGTTCTGCCATCTCGAGATGGCAGAACTGTAGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-595s1c1
Sequence:CCGGGACGACTCTAAATATCCTGTTCTCGAGAACAGGATATTTAGAGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-778s1c1
Sequence:CCGGGCTGCTTATCCAGAGCTGTTTCTCGAGAAACAGCTCTGGATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-420s1c1
Sequence:CCGGCCAGAGTGATTTGAGATACAACTCGAGTTGTATCTCAAATCACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010554
IL1A MISSION shRNA Lentiviral Transduction Particles
interleukin 1, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010554.3-1782s1c1
Sequence:CCGGCCAACCATCTAAAGATGGAAACTCGAGTTTCCATCTTTAGATGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-114s1c1
Sequence:CCGGCGAAGACTACAGTTCTGCCATCTCGAGATGGCAGAACTGTAGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-595s1c1
Sequence:CCGGGACGACTCTAAATATCCTGTTCTCGAGAACAGGATATTTAGAGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-778s1c1
Sequence:CCGGGCTGCTTATCCAGAGCTGTTTCTCGAGAAACAGCTCTGGATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010554.3-420s1c1
Sequence:CCGGCCAGAGTGATTTGAGATACAACTCGAGTTGTATCTCAAATCACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000575
IL1A MISSION shRNA Bacterial Glycerol Stock
interleukin 1, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1375s1c1
Sequence:CCGGGCCCTCAATCAAAGTATAATTCTCGAGAATTATACTTTGATTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1262s1c1
Sequence:CCGGCCAATGACTCAGAGGAAGAAACTCGAGTTTCTTCCTCTGAGTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1152s1c1
Sequence:CCGGGCTTACCTTCAAGGAGAGCATCTCGAGATGCTCTCCTTGAAGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1503s1c1
Sequence:CCGGCGTGATTCTAAGAATCTCAAACTCGAGTTTGAGATTCTTAGAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1732s1c1
Sequence:CCGGCCACCCTCTATCACTGACTTTCTCGAGAAAGTCAGTGATAGAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000575.3-1092s21c1
Sequence:CCGGTGAAGGCTGCATGGATCAATCCTCGAGGATTGATCCATGCAGCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000575.3-2069s21c1
Sequence:CCGGTATTACAGATGGGCAAATTAACTCGAGTTAATTTGCCCATCTGTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000575.3-1925s21c1
Sequence:CCGGGTGGAACCAACACTAACATATCTCGAGATATGTTAGTGTTGGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000575
IL1A MISSION shRNA shRNA Plasmid DNA
interleukin 1, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1375s1c1
Sequence:CCGGGCCCTCAATCAAAGTATAATTCTCGAGAATTATACTTTGATTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1262s1c1
Sequence:CCGGCCAATGACTCAGAGGAAGAAACTCGAGTTTCTTCCTCTGAGTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1152s1c1
Sequence:CCGGGCTTACCTTCAAGGAGAGCATCTCGAGATGCTCTCCTTGAAGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1503s1c1
Sequence:CCGGCGTGATTCTAAGAATCTCAAACTCGAGTTTGAGATTCTTAGAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1732s1c1
Sequence:CCGGCCACCCTCTATCACTGACTTTCTCGAGAAAGTCAGTGATAGAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000575.3-1092s21c1
Sequence:CCGGTGAAGGCTGCATGGATCAATCCTCGAGGATTGATCCATGCAGCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000575.3-2069s21c1
Sequence:CCGGTATTACAGATGGGCAAATTAACTCGAGTTAATTTGCCCATCTGTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000575.3-1925s21c1
Sequence:CCGGGTGGAACCAACACTAACATATCTCGAGATATGTTAGTGTTGGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000575
IL1A MISSION shRNA Lentiviral Transduction Particles
interleukin 1, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1375s1c1
Sequence:CCGGGCCCTCAATCAAAGTATAATTCTCGAGAATTATACTTTGATTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1262s1c1
Sequence:CCGGCCAATGACTCAGAGGAAGAAACTCGAGTTTCTTCCTCTGAGTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1152s1c1
Sequence:CCGGGCTTACCTTCAAGGAGAGCATCTCGAGATGCTCTCCTTGAAGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1503s1c1
Sequence:CCGGCGTGATTCTAAGAATCTCAAACTCGAGTTTGAGATTCTTAGAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000575.3-1732s1c1
Sequence:CCGGCCACCCTCTATCACTGACTTTCTCGAGAAAGTCAGTGATAGAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000575.3-1092s21c1
Sequence:CCGGTGAAGGCTGCATGGATCAATCCTCGAGGATTGATCCATGCAGCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000575.3-2069s21c1
Sequence:CCGGTATTACAGATGGGCAAATTAACTCGAGTTAATTTGCCCATCTGTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000575.3-1925s21c1
Sequence:CCGGGTGGAACCAACACTAACATATCTCGAGATATGTTAGTGTTGGTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)